Incidental Mutation 'R2179:Cpm'
ID237064
Institutional Source Beutler Lab
Gene Symbol Cpm
Ensembl Gene ENSMUSG00000020183
Gene Namecarboxypeptidase M
Synonyms
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117629500-117687352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117683361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 391 (D391E)
Ref Sequence ENSEMBL: ENSMUSP00000020399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020399]
Predicted Effect probably benign
Transcript: ENSMUST00000020399
AA Change: D391E

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020399
Gene: ENSMUSG00000020183
AA Change: D391E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Zn_pept 22 406 2.03e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141991
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound arginine/lysine carboxypeptidase. Its expression is associated with monocyte to macrophage differentiation. This encoded protein contains hydrophobic regions at the amino and carboxy termini and has 6 potential asparagine-linked glycosylation sites. The active site residues of carboxypeptidases A and B are conserved in this protein. Three alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Cpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Cpm APN 10 117676066 missense probably damaging 1.00
IGL01400:Cpm APN 10 117659775 missense probably benign 0.25
IGL02655:Cpm APN 10 117683281 missense probably benign 0.01
IGL02724:Cpm APN 10 117629851 missense probably damaging 1.00
IGL03144:Cpm APN 10 117683414 missense probably benign 0.03
R0898:Cpm UTSW 10 117676106 splice site probably benign
R2213:Cpm UTSW 10 117659839 missense probably damaging 1.00
R4622:Cpm UTSW 10 117670297 missense possibly damaging 0.91
R4623:Cpm UTSW 10 117670297 missense possibly damaging 0.91
R4658:Cpm UTSW 10 117668051 missense probably benign 0.43
R4714:Cpm UTSW 10 117675985 missense probably damaging 0.97
R4991:Cpm UTSW 10 117668103 missense probably damaging 1.00
R5430:Cpm UTSW 10 117676081 missense possibly damaging 0.92
R5765:Cpm UTSW 10 117671733 missense probably benign 0.09
R6757:Cpm UTSW 10 117671638 missense probably damaging 1.00
R6803:Cpm UTSW 10 117676097 splice site probably null
R7509:Cpm UTSW 10 117659840 missense probably damaging 1.00
R7761:Cpm UTSW 10 117683435 missense possibly damaging 0.64
R8171:Cpm UTSW 10 117683315 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTCAAGCCACGCATGCAC -3'
(R):5'- TAACCGGGAGTAACCAATCCCTG -3'

Sequencing Primer
(F):5'- ATGCACCGCTCAAAGGG -3'
(R):5'- GATTCCCGGAAGTCGAGTTTCAC -3'
Posted On2014-10-02