Incidental Mutation 'R2179:Slc25a17'
ID237081
Institutional Source Beutler Lab
Gene Symbol Slc25a17
Ensembl Gene ENSMUSG00000022404
Gene Namesolute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
Synonyms34kDa, PMP34
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81318911-81360812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81337950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000155823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023040] [ENSMUST00000230309] [ENSMUST00000231140]
Predicted Effect probably benign
Transcript: ENSMUST00000023040
AA Change: V107A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023040
Gene: ENSMUSG00000022404
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Mito_carr 6 97 1e-17 PFAM
Pfam:Mito_carr 97 197 6.3e-24 PFAM
Pfam:Mito_carr 199 297 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229617
Predicted Effect probably benign
Transcript: ENSMUST00000230309
Predicted Effect probably benign
Transcript: ENSMUST00000230983
Predicted Effect probably benign
Transcript: ENSMUST00000231140
AA Change: V107A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that belongs to the family of mitochondrial solute carriers. It is expressed in the liver, and is likely involved in transport. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Olfr979 T C 9: 40,000,924 Y101C probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Slc25a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Slc25a17 APN 15 81327326 nonsense probably null
IGL02655:Slc25a17 APN 15 81323643 missense probably benign 0.02
IGL03258:Slc25a17 APN 15 81329042 splice site probably benign
Acquisitive UTSW 15 81327284 missense probably benign 0.01
big_guy UTSW 15 81360774 utr 5 prime probably benign
grubbing UTSW 15 81329145 missense probably damaging 1.00
R0114:Slc25a17 UTSW 15 81337959 missense probably damaging 1.00
R0763:Slc25a17 UTSW 15 81323706 splice site probably benign
R1628:Slc25a17 UTSW 15 81360724 missense possibly damaging 0.92
R3420:Slc25a17 UTSW 15 81360700 missense probably benign 0.04
R3421:Slc25a17 UTSW 15 81360700 missense probably benign 0.04
R3687:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R3688:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R4707:Slc25a17 UTSW 15 81327326 missense probably damaging 0.97
R5617:Slc25a17 UTSW 15 81360774 utr 5 prime probably benign
R5650:Slc25a17 UTSW 15 81329176 splice site probably null
R5817:Slc25a17 UTSW 15 81327060 missense probably damaging 0.97
R6207:Slc25a17 UTSW 15 81329064 missense probably damaging 1.00
R6727:Slc25a17 UTSW 15 81337953 missense probably benign 0.05
R7331:Slc25a17 UTSW 15 81329145 missense probably damaging 1.00
R8101:Slc25a17 UTSW 15 81338047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGTTCCAGGACAGCCAG -3'
(R):5'- GCCCATGGCTTTTGTTCATG -3'

Sequencing Primer
(F):5'- GGGCTACACAGAGAAACCCTGTC -3'
(R):5'- CATGGCTTTTGTTCATGATCTTTAC -3'
Posted On2014-10-02