Incidental Mutation 'R2180:Gigyf2'
ID237095
Institutional Source Beutler Lab
Gene Symbol Gigyf2
Ensembl Gene ENSMUSG00000048000
Gene NameGRB10 interacting GYF protein 2
Synonyms2610016F01Rik, Tnrc15, A830080H02Rik
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87326998-87450796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87416920 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 525 (G525D)
Ref Sequence ENSEMBL: ENSMUSP00000129046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174501]
Predicted Effect unknown
Transcript: ENSMUST00000027475
AA Change: G582D
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000
AA Change: G582D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158988
Predicted Effect probably damaging
Transcript: ENSMUST00000164992
AA Change: G525D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000
AA Change: G525D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172776
Predicted Effect unknown
Transcript: ENSMUST00000172794
AA Change: G576D
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000
AA Change: G576D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172964
AA Change: G582D
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000
AA Change: G582D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173173
AA Change: G575D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000
AA Change: G575D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173235
AA Change: G403D
SMART Domains Protein: ENSMUSP00000134677
Gene: ENSMUSG00000048000
AA Change: G403D

DomainStartEndE-ValueType
low complexity region 69 107 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
internal_repeat_1 166 206 3.2e-5 PROSPERO
internal_repeat_1 226 262 3.2e-5 PROSPERO
GYF 357 412 2.83e-26 SMART
low complexity region 442 489 N/A INTRINSIC
coiled coil region 544 745 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173636
Predicted Effect unknown
Transcript: ENSMUST00000174501
AA Change: G582D
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000
AA Change: G582D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains CAG trinucleotide repeats and encodes a protein containing several stretches of polyglutamine residues. The encoded protein may be involved in the regulation of tyrosine kinase receptor signaling. This gene is located in a chromosomal region that was genetically linked to Parkinson disease type 11, and mutations in this gene were thought to be causative for this disease. However, more recent studies in different populations have been unable to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal and postnatal lethality. Mice heterozygous for a knock-out allele exhibit impaired motor coordination with motor neuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Gigyf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gigyf2 APN 1 87436850 missense probably damaging 0.99
IGL01828:Gigyf2 APN 1 87419098 missense probably damaging 1.00
IGL02222:Gigyf2 APN 1 87410863 unclassified probably null
IGL02259:Gigyf2 APN 1 87411837 missense probably damaging 1.00
IGL02562:Gigyf2 APN 1 87407375 missense probably benign 0.15
IGL02565:Gigyf2 APN 1 87442136 missense probably damaging 1.00
IGL02695:Gigyf2 APN 1 87416827 missense probably benign 0.07
IGL03264:Gigyf2 APN 1 87449068 splice site probably benign
Flop UTSW 1 87365266 missense probably damaging 1.00
FR4449:Gigyf2 UTSW 1 87428585 unclassified probably benign
PIT4260001:Gigyf2 UTSW 1 87419106 missense unknown
R0041:Gigyf2 UTSW 1 87378976 missense probably damaging 1.00
R0126:Gigyf2 UTSW 1 87411875 splice site probably benign
R0190:Gigyf2 UTSW 1 87428688 unclassified probably benign
R0244:Gigyf2 UTSW 1 87379015 missense possibly damaging 0.96
R0492:Gigyf2 UTSW 1 87440846 missense probably damaging 1.00
R0526:Gigyf2 UTSW 1 87421493 missense probably benign 0.00
R0612:Gigyf2 UTSW 1 87449080 missense probably damaging 1.00
R0731:Gigyf2 UTSW 1 87407727 splice site probably benign
R0783:Gigyf2 UTSW 1 87407161 missense probably damaging 0.99
R1445:Gigyf2 UTSW 1 87443638 splice site probably benign
R1620:Gigyf2 UTSW 1 87449128 missense probably damaging 1.00
R1678:Gigyf2 UTSW 1 87416983 missense probably benign 0.44
R2008:Gigyf2 UTSW 1 87374113 critical splice donor site probably null
R2111:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R2112:Gigyf2 UTSW 1 87440730 missense probably damaging 0.99
R3438:Gigyf2 UTSW 1 87440580 missense probably damaging 0.96
R3690:Gigyf2 UTSW 1 87421516 missense possibly damaging 0.80
R4089:Gigyf2 UTSW 1 87443672 missense probably damaging 1.00
R4411:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4412:Gigyf2 UTSW 1 87436860 missense probably damaging 1.00
R4489:Gigyf2 UTSW 1 87440826 missense probably damaging 1.00
R4743:Gigyf2 UTSW 1 87365248 nonsense probably null
R4769:Gigyf2 UTSW 1 87440849 missense probably damaging 1.00
R4854:Gigyf2 UTSW 1 87354413 unclassified probably benign
R5215:Gigyf2 UTSW 1 87365266 missense probably damaging 1.00
R5326:Gigyf2 UTSW 1 87425138 unclassified probably benign
R5771:Gigyf2 UTSW 1 87446328 missense possibly damaging 0.90
R5813:Gigyf2 UTSW 1 87440763 missense probably damaging 0.99
R5964:Gigyf2 UTSW 1 87407167 missense probably damaging 1.00
R6026:Gigyf2 UTSW 1 87440732 missense probably damaging 0.99
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6035:Gigyf2 UTSW 1 87410728 missense possibly damaging 0.93
R6784:Gigyf2 UTSW 1 87443674 missense probably damaging 1.00
R6800:Gigyf2 UTSW 1 87419176 missense possibly damaging 0.68
R6991:Gigyf2 UTSW 1 87407136 missense probably damaging 1.00
R7224:Gigyf2 UTSW 1 87403725 missense unknown
R7464:Gigyf2 UTSW 1 87428604 missense unknown
R7554:Gigyf2 UTSW 1 87407570 missense unknown
R7658:Gigyf2 UTSW 1 87419138 missense unknown
R8032:Gigyf2 UTSW 1 87407013 missense unknown
R8070:Gigyf2 UTSW 1 87440907 missense probably benign 0.03
X0065:Gigyf2 UTSW 1 87411867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAATGAACATGAGACTCAGGG -3'
(R):5'- TGCACAGTAAGTTCTGAAAAGGTC -3'

Sequencing Primer
(F):5'- TGAACATGAGACTCAGGGAATATAC -3'
(R):5'- CTATGATCCCAGCAACTTAGGTAGG -3'
Posted On2014-10-02