Incidental Mutation 'R2180:Anxa9'
ID237104
Institutional Source Beutler Lab
Gene Symbol Anxa9
Ensembl Gene ENSMUSG00000015702
Gene Nameannexin A9
Synonyms
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95296096-95307176 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 95306424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000107183] [ENSMUST00000123365] [ENSMUST00000164406]
Predicted Effect probably null
Transcript: ENSMUST00000015846
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098867
Predicted Effect probably null
Transcript: ENSMUST00000107183
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123365
Predicted Effect probably null
Transcript: ENSMUST00000164406
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198947
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Anxa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Anxa9 APN 3 95302432 splice site probably benign
IGL01618:Anxa9 APN 3 95300536 unclassified probably null
IGL02272:Anxa9 APN 3 95305894 missense probably benign 0.11
R0012:Anxa9 UTSW 3 95308095 unclassified probably benign
R0128:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0130:Anxa9 UTSW 3 95302422 missense probably benign 0.02
R0356:Anxa9 UTSW 3 95308076 unclassified probably benign
R1656:Anxa9 UTSW 3 95300573 missense probably benign 0.02
R1967:Anxa9 UTSW 3 95300608 missense probably benign 0.00
R2359:Anxa9 UTSW 3 95302751 missense probably damaging 1.00
R3155:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3156:Anxa9 UTSW 3 95302405 missense probably benign 0.04
R3767:Anxa9 UTSW 3 95301114 missense probably benign 0.00
R4693:Anxa9 UTSW 3 95297356 missense probably benign 0.00
R4974:Anxa9 UTSW 3 95308013 unclassified probably benign
R5435:Anxa9 UTSW 3 95297250 missense probably damaging 1.00
R6342:Anxa9 UTSW 3 95296790 makesense probably null
R7272:Anxa9 UTSW 3 95305873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCATCTTCTGGCCTTTAAG -3'
(R):5'- GCCAGAAGCTAAGTCCTTCCTC -3'

Sequencing Primer
(F):5'- GCACTAACCTGGCAAGTGTG -3'
(R):5'- GAAGCTAAGTCCTTCCTCTCGCC -3'
Posted On2014-10-02