Incidental Mutation 'R2180:Olfr446'
ID237116
Institutional Source Beutler Lab
Gene Symbol Olfr446
Ensembl Gene ENSMUSG00000073111
Gene Nameolfactory receptor 446
SynonymsGA_x6K02T2P3E9-4632269-4631343, MOR261-12
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42921377-42931141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42927525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 98 (T98I)
Ref Sequence ENSEMBL: ENSMUSP00000150255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
Predicted Effect probably benign
Transcript: ENSMUST00000101461
AA Change: T98I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: T98I

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215369
AA Change: T98I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215686
AA Change: T98I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216199
AA Change: T98I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Olfr446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Olfr446 APN 6 42927896 missense probably benign 0.24
IGL03164:Olfr446 APN 6 42928130 nonsense probably null
PIT4519001:Olfr446 UTSW 6 42927644 missense probably damaging 1.00
R1760:Olfr446 UTSW 6 42927497 missense possibly damaging 0.90
R1883:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R1884:Olfr446 UTSW 6 42927830 missense probably damaging 0.99
R3001:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R3002:Olfr446 UTSW 6 42927954 missense probably damaging 1.00
R4435:Olfr446 UTSW 6 42928089 missense probably damaging 1.00
R4544:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R4546:Olfr446 UTSW 6 42927414 missense probably damaging 1.00
R5009:Olfr446 UTSW 6 42927433 missense probably damaging 1.00
R5236:Olfr446 UTSW 6 42927781 missense probably benign 0.04
R5290:Olfr446 UTSW 6 42928038 missense probably damaging 0.98
R5297:Olfr446 UTSW 6 42927437 missense probably benign 0.17
R7371:Olfr446 UTSW 6 42927535 nonsense probably null
X0065:Olfr446 UTSW 6 42928056 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACGTTGATGGGAAATGGG -3'
(R):5'- TTTGTGGCCCACAGAATGG -3'

Sequencing Primer
(F):5'- AAATGGGATTATCCTGGGGCTCATC -3'
(R):5'- CCACAGAATGGGAGTCTTAGAATG -3'
Posted On2014-10-02