Incidental Mutation 'R2180:Lrrtm1'
ID237117
Institutional Source Beutler Lab
Gene Symbol Lrrtm1
Ensembl Gene ENSMUSG00000060780
Gene Nameleucine rich repeat transmembrane neuronal 1
Synonyms4632401D06Rik
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location77242689-77257791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77244346 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 262 (D262G)
Ref Sequence ENSEMBL: ENSMUSP00000124373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]
Predicted Effect probably damaging
Transcript: ENSMUST00000020400
AA Change: D262G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: D262G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075340
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159616
AA Change: D262G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: D262G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159626
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161677
AA Change: D262G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: D262G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161811
SMART Domains Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161846
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Lrrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Lrrtm1 APN 6 77244063 missense probably benign 0.00
IGL01011:Lrrtm1 APN 6 77244235 unclassified probably null
IGL01125:Lrrtm1 APN 6 77244453 missense probably damaging 1.00
IGL01924:Lrrtm1 APN 6 77244186 missense possibly damaging 0.81
IGL02508:Lrrtm1 APN 6 77244591 missense probably damaging 1.00
IGL03005:Lrrtm1 APN 6 77244156 missense probably damaging 1.00
IGL03076:Lrrtm1 APN 6 77244585 missense probably damaging 1.00
R0077:Lrrtm1 UTSW 6 77243872 missense probably damaging 1.00
R0540:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0607:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0927:Lrrtm1 UTSW 6 77244860 missense probably damaging 1.00
R1742:Lrrtm1 UTSW 6 77244091 missense probably damaging 1.00
R1762:Lrrtm1 UTSW 6 77244697 missense probably benign
R1933:Lrrtm1 UTSW 6 77244966 intron probably null
R1934:Lrrtm1 UTSW 6 77244966 intron probably null
R2267:Lrrtm1 UTSW 6 77244013 missense probably damaging 0.97
R2914:Lrrtm1 UTSW 6 77244979 missense probably damaging 0.99
R2937:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R2938:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R4604:Lrrtm1 UTSW 6 77244144 missense probably damaging 1.00
R4908:Lrrtm1 UTSW 6 77244678 missense probably benign 0.01
R4910:Lrrtm1 UTSW 6 77244901 missense probably damaging 1.00
R5739:Lrrtm1 UTSW 6 77244889 missense probably damaging 0.99
R6604:Lrrtm1 UTSW 6 77244238 missense possibly damaging 0.70
R6845:Lrrtm1 UTSW 6 77243881 missense probably benign 0.02
R7048:Lrrtm1 UTSW 6 77244169 missense probably damaging 1.00
R7203:Lrrtm1 UTSW 6 77243601 missense probably damaging 1.00
R7783:Lrrtm1 UTSW 6 77244253 missense probably damaging 1.00
R7826:Lrrtm1 UTSW 6 77244112 splice site probably null
RF018:Lrrtm1 UTSW 6 77244351 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CGGCTTGTTCAAGCTCACAG -3'
(R):5'- CAAGTTAGCATCGTAACGTCC -3'

Sequencing Primer
(F):5'- GAGCTACACCTGGAGCATAATGAC -3'
(R):5'- TTAGCATCGTAACGTCCCTGGAAG -3'
Posted On2014-10-02