Incidental Mutation 'R2180:Sec14l2'
ID237138
Institutional Source Beutler Lab
Gene Symbol Sec14l2
Ensembl Gene ENSMUSG00000003585
Gene NameSEC14-like lipid binding 2
SynonymsSpf, tap, 1300013M05Rik
MMRRC Submission 040182-MU
Accession Numbers

Ncbi RefSeq: NM_144520.2; MGI:1915065

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4097039-4123415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4108964 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 194 (A194T)
Ref Sequence ENSEMBL: ENSMUSP00000003681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003681]
Predicted Effect probably damaging
Transcript: ENSMUST00000003681
AA Change: A194T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003681
Gene: ENSMUSG00000003585
AA Change: A194T

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.16e-6 SMART
SEC14 76 246 8.31e-62 SMART
Blast:SEC14 257 338 2e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 3771069
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic protein which belongs to a family of lipid-binding proteins including Sec14p, alpha-tocopherol transfer protein, and cellular retinol-binding protein. The encoded protein stimulates squalene monooxygenase which is a downstream enzyme in the cholesterol biosynthetic pathway. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased cholesterol synthesis and plasma levels under fasting conditions compared to wild-type mice. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Sec14l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Sec14l2 APN 11 4098317 missense probably benign
IGL01369:Sec14l2 APN 11 4103432 missense probably benign 0.03
IGL01404:Sec14l2 APN 11 4116710 missense possibly damaging 0.71
IGL01622:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL01623:Sec14l2 APN 11 4103966 missense possibly damaging 0.58
IGL02007:Sec14l2 APN 11 4111114 missense probably benign 0.00
IGL02632:Sec14l2 APN 11 4111222 missense probably benign 0.00
IGL02644:Sec14l2 APN 11 4103380 splice site probably benign
Samoas UTSW 11 4103980 missense possibly damaging 0.74
P0027:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
PIT1430001:Sec14l2 UTSW 11 4109209 nonsense probably null
R0113:Sec14l2 UTSW 11 4103661 splice site probably benign
R1705:Sec14l2 UTSW 11 4103980 missense possibly damaging 0.74
R2044:Sec14l2 UTSW 11 4111435 splice site probably benign
R2215:Sec14l2 UTSW 11 4109169 missense probably damaging 1.00
R5301:Sec14l2 UTSW 11 4118727 start gained probably benign
R5668:Sec14l2 UTSW 11 4109189 missense probably damaging 1.00
R5949:Sec14l2 UTSW 11 4108972 missense probably damaging 1.00
R6050:Sec14l2 UTSW 11 4111477 missense probably benign 0.36
R6369:Sec14l2 UTSW 11 4103962 missense possibly damaging 0.69
R6467:Sec14l2 UTSW 11 4111161 missense probably damaging 1.00
R6798:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7142:Sec14l2 UTSW 11 4098379 missense probably benign 0.04
R7385:Sec14l2 UTSW 11 4116750 nonsense probably null
R7594:Sec14l2 UTSW 11 4111213 missense probably damaging 1.00
R7704:Sec14l2 UTSW 11 4108574 missense probably benign 0.19
T0722:Sec14l2 UTSW 11 4103673 critical splice donor site probably null
X0067:Sec14l2 UTSW 11 4116737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGAGCTGTAAAGCATC -3'
(R):5'- ACCTCTGGAAACCTGCAGTG -3'

Sequencing Primer
(F):5'- CTGTACAGGTTAAGGTCAACGTC -3'
(R):5'- AACCTGCAGTGGAGGCCTATG -3'
Posted On2014-10-02