Incidental Mutation 'R0173:Mctp2'
ID23714
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 72247107 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323]
Predicted Effect probably null
Transcript: ENSMUST00000079323
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1356:Mctp2 UTSW 7 72164723 unclassified probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R2471:Mctp2 UTSW 7 72161161 nonsense probably null
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5878:Mctp2 UTSW 7 72214108 missense probably benign 0.01
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
R7468:Mctp2 UTSW 7 72211690 missense probably damaging 1.00
R7746:Mctp2 UTSW 7 72185796 missense probably benign
R7765:Mctp2 UTSW 7 72090331 splice site probably null
R7822:Mctp2 UTSW 7 72127187 missense possibly damaging 0.90
R7984:Mctp2 UTSW 7 72103189 missense possibly damaging 0.94
R8416:Mctp2 UTSW 7 72202462 missense probably benign 0.12
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCATGCAATGTTTGACCGTGTTC -3'
(R):5'- TGGCCTGACAGACACTCCTAAGTTC -3'

Sequencing Primer
(F):5'- GCCTTTCTTCAAAGGGGACAAATG -3'
(R):5'- GTTTCCCACAAACATGAAAGTAGG -3'
Posted On2013-04-16