Incidental Mutation 'R2180:Pom121l2'
ID237148
Institutional Source Beutler Lab
Gene Symbol Pom121l2
Ensembl Gene ENSMUSG00000016982
Gene NamePOM121 membrane glycoprotein-like 2 (rat)
SynonymsLOC195236
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21981194-21988734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21981975 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 139 (N139D)
Ref Sequence ENSEMBL: ENSMUSP00000113688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017126] [ENSMUST00000117882]
Predicted Effect probably benign
Transcript: ENSMUST00000017126
AA Change: N139D

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017126
Gene: ENSMUSG00000016982
AA Change: N139D

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 3.5e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
low complexity region 517 526 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117882
AA Change: N139D

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113688
Gene: ENSMUSG00000016982
AA Change: N139D

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 2e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Pom121l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Pom121l2 APN 13 21982275 missense possibly damaging 0.70
IGL02223:Pom121l2 APN 13 21982095 missense probably benign 0.01
R0401:Pom121l2 UTSW 13 21982225 missense probably benign 0.01
R0402:Pom121l2 UTSW 13 21988479 splice site probably benign
R0437:Pom121l2 UTSW 13 21983205 missense possibly damaging 0.72
R0575:Pom121l2 UTSW 13 21984168 missense probably damaging 0.99
R0605:Pom121l2 UTSW 13 21982036 missense probably damaging 1.00
R0892:Pom121l2 UTSW 13 21982474 missense possibly damaging 0.49
R0992:Pom121l2 UTSW 13 21982759 missense probably benign 0.01
R1259:Pom121l2 UTSW 13 21982127 nonsense probably null
R1564:Pom121l2 UTSW 13 21983353 missense possibly damaging 0.86
R1603:Pom121l2 UTSW 13 21983344 missense probably damaging 1.00
R1836:Pom121l2 UTSW 13 21983784 missense probably benign 0.03
R1970:Pom121l2 UTSW 13 21983472 missense probably damaging 0.98
R2018:Pom121l2 UTSW 13 21982734 missense possibly damaging 0.54
R2277:Pom121l2 UTSW 13 21984247 missense probably benign
R2365:Pom121l2 UTSW 13 21983784 missense probably benign 0.20
R3951:Pom121l2 UTSW 13 21982128 missense probably damaging 1.00
R4371:Pom121l2 UTSW 13 21982239 missense probably benign 0.01
R4574:Pom121l2 UTSW 13 21984402 missense probably benign 0.02
R4593:Pom121l2 UTSW 13 21984453 missense probably damaging 1.00
R4983:Pom121l2 UTSW 13 21983814 missense probably benign 0.02
R5320:Pom121l2 UTSW 13 21981845 nonsense probably null
R5661:Pom121l2 UTSW 13 21984255 missense possibly damaging 0.90
R5662:Pom121l2 UTSW 13 21982188 missense probably benign 0.01
R5908:Pom121l2 UTSW 13 21981814 missense probably damaging 0.99
R5980:Pom121l2 UTSW 13 21983376 missense probably damaging 0.96
R6145:Pom121l2 UTSW 13 21982302 nonsense probably null
R6160:Pom121l2 UTSW 13 21983668 missense possibly damaging 0.52
R6327:Pom121l2 UTSW 13 21982332 missense probably damaging 1.00
R6504:Pom121l2 UTSW 13 21983461 missense possibly damaging 0.55
R6745:Pom121l2 UTSW 13 21983698 missense probably benign 0.00
R6750:Pom121l2 UTSW 13 21981937 missense probably damaging 1.00
R6752:Pom121l2 UTSW 13 21981769 missense probably damaging 0.99
R6796:Pom121l2 UTSW 13 21983524 missense probably benign 0.09
R6984:Pom121l2 UTSW 13 21982021 missense probably benign 0.33
R7284:Pom121l2 UTSW 13 21982605 missense probably damaging 1.00
R7287:Pom121l2 UTSW 13 21984332 missense probably benign 0.16
R7568:Pom121l2 UTSW 13 21982626 missense probably benign 0.03
R7624:Pom121l2 UTSW 13 21983529 missense probably damaging 0.97
R7832:Pom121l2 UTSW 13 21983878 missense possibly damaging 0.49
R7915:Pom121l2 UTSW 13 21983878 missense possibly damaging 0.49
Z1177:Pom121l2 UTSW 13 21988486 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACCCTACCGCTTTCGTCAG -3'
(R):5'- CACTTTTCAACAGGGGCTTAAAGG -3'

Sequencing Primer
(F):5'- CTACCGCTTTCGTCAGTGAGG -3'
(R):5'- GCTTAAAGGCGGACCATACG -3'
Posted On2014-10-02