Incidental Mutation 'R2180:Zfp738'
ID237149
Institutional Source Beutler Lab
Gene Symbol Zfp738
Ensembl Gene ENSMUSG00000048280
Gene Namezinc finger protein 738
Synonyms6720487G11Rik, 3830402I07Rik
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67658685-67687071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67671194 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 226 (T226I)
Ref Sequence ENSEMBL: ENSMUSP00000121275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110973] [ENSMUST00000125495] [ENSMUST00000137496] [ENSMUST00000175678] [ENSMUST00000175821]
Predicted Effect probably benign
Transcript: ENSMUST00000110973
SMART Domains Protein: ENSMUSP00000106600
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 2 62 1.97e-31 SMART
SCOP:d1fgja_ 76 119 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125495
SMART Domains Protein: ENSMUSP00000135683
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137496
AA Change: T226I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121275
Gene: ENSMUSG00000048280
AA Change: T226I

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
ZnF_C2H2 91 111 3.13e1 SMART
ZnF_C2H2 119 141 9.56e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 8.34e-3 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
ZnF_C2H2 343 365 8.34e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 427 449 9.58e-3 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
ZnF_C2H2 567 589 5.42e-2 SMART
ZnF_C2H2 595 617 7.78e-3 SMART
ZnF_C2H2 623 645 2.05e-2 SMART
ZnF_C2H2 651 673 2.57e-3 SMART
ZnF_C2H2 679 701 7.26e-3 SMART
ZnF_C2H2 735 757 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175678
SMART Domains Protein: ENSMUSP00000134865
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 15 75 1.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175821
SMART Domains Protein: ENSMUSP00000135050
Gene: ENSMUSG00000048280

DomainStartEndE-ValueType
KRAB 5 65 1.97e-31 SMART
ZnF_C2H2 81 101 3.13e1 SMART
ZnF_C2H2 109 131 9.56e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225507
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptpn13 T G 5: 103,569,558 H1855Q probably damaging Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Zfp738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zfp738 APN 13 67683401 critical splice donor site probably null
IGL01734:Zfp738 APN 13 67683444 utr 5 prime probably benign
IGL01980:Zfp738 APN 13 67669977 missense possibly damaging 0.80
IGL02052:Zfp738 APN 13 67671481 missense possibly damaging 0.87
IGL02330:Zfp738 APN 13 67671431 missense probably damaging 0.99
IGL02686:Zfp738 APN 13 67673652 missense probably damaging 1.00
I2505:Zfp738 UTSW 13 67673067 missense probably benign 0.36
R0219:Zfp738 UTSW 13 67683389 intron probably benign
R0491:Zfp738 UTSW 13 67670021 missense possibly damaging 0.87
R0722:Zfp738 UTSW 13 67671524 missense probably benign 0.09
R1116:Zfp738 UTSW 13 67670243 unclassified probably null
R1425:Zfp738 UTSW 13 67670775 missense possibly damaging 0.77
R1854:Zfp738 UTSW 13 67670357 missense probably damaging 1.00
R2095:Zfp738 UTSW 13 67671303 missense probably damaging 1.00
R2171:Zfp738 UTSW 13 67670977 nonsense probably null
R2225:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2226:Zfp738 UTSW 13 67670312 missense probably damaging 1.00
R2907:Zfp738 UTSW 13 67670112 missense probably benign 0.33
R3605:Zfp738 UTSW 13 67671389 nonsense probably null
R4731:Zfp738 UTSW 13 67669914 missense probably damaging 1.00
R5037:Zfp738 UTSW 13 67670201 missense probably damaging 1.00
R5223:Zfp738 UTSW 13 67673063 missense probably damaging 0.99
R5259:Zfp738 UTSW 13 67669686 missense probably benign
R5358:Zfp738 UTSW 13 67671012 missense probably damaging 0.98
R6404:Zfp738 UTSW 13 67671060 missense possibly damaging 0.89
R6874:Zfp738 UTSW 13 67670263 missense possibly damaging 0.93
R7041:Zfp738 UTSW 13 67670301 missense probably damaging 1.00
R7172:Zfp738 UTSW 13 67670408 missense probably damaging 1.00
R7178:Zfp738 UTSW 13 67673028 missense probably damaging 1.00
R7308:Zfp738 UTSW 13 67669553 missense probably benign 0.00
R7386:Zfp738 UTSW 13 67670250 missense probably damaging 1.00
R7453:Zfp738 UTSW 13 67670355 missense probably benign 0.42
R7456:Zfp738 UTSW 13 67669500 missense probably damaging 1.00
R7467:Zfp738 UTSW 13 67672961 missense probably benign 0.03
R7615:Zfp738 UTSW 13 67670203 missense probably damaging 0.96
R7663:Zfp738 UTSW 13 67683401 critical splice donor site probably null
R7752:Zfp738 UTSW 13 67672991 nonsense probably null
R7901:Zfp738 UTSW 13 67672991 nonsense probably null
R7984:Zfp738 UTSW 13 67672991 nonsense probably null
R8042:Zfp738 UTSW 13 67670891 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACAGAGAACGGAAAGCCT -3'
(R):5'- TCCATAGTCCATCATTAAGTTCTGAA -3'

Sequencing Primer
(F):5'- CGGAAAGCCTTTTGACATACTTCAC -3'
(R):5'- GGCAAGGCCTTCTGCATTC -3'
Posted On2014-10-02