Mutagenetix > Incidental Mutations

Incidental Mutation 'R2180:Adamts5'

237156

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

040182-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R2180 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85887924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 377 (D377G)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: D377G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: D377G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	A	4: 41,507,170	M209L	probably benign	Het
Adgrl4	A	T	3: 151,500,142	I164F	probably damaging	Het
Anxa9	T	C	3: 95,306,424		probably null	Het
Aox4	A	T	1: 58,213,067	T34S	probably benign	Het
Asic1	G	T	15: 99,671,965	V56F	probably benign	Het
Atpaf1	T	C	4: 115,788,360	M1T	probably null	Het
Axin1	A	G	17: 26,143,335	T218A	probably benign	Het
BC049762	C	A	11: 51,254,610	W50L	probably damaging	Het
Bdp1	ATTCTTCTTCTTCTTCTTC	ATTCTTCTTCTTCTTCTTCTTC	13: 100,061,405		probably benign	Het
Birc6	T	C	17: 74,612,151	I1988T	probably benign	Het
Btbd7	A	T	12: 102,785,897	D869E	probably damaging	Het
Caln1	T	C	5: 130,839,408	*220Q	probably null	Het
Ccdc150	G	A	1: 54,272,547		probably null	Het
Ccnt1	A	T	15: 98,543,600	S596T	possibly damaging	Het
Cd44	C	T	2: 102,828,610	G640E	possibly damaging	Het
Cep192	A	G	18: 67,824,742	E582G	possibly damaging	Het
Clcnkb	G	T	4: 141,409,508		probably null	Het
Dhx29	T	C	13: 112,962,872		probably null	Het
Dnah8	T	C	17: 30,840,647	F4407S	probably benign	Het
Enah	A	T	1: 181,918,459	M419K	probably damaging	Het
Fam129a	A	T	1: 151,718,078	H838L	probably benign	Het
Fancd2	A	T	6: 113,574,637	T1055S	probably benign	Het
Gigyf2	G	A	1: 87,416,920	G525D	probably damaging	Het
Gm5800	T	A	14: 51,715,994	K55*	probably null	Het
Gpr149	A	G	3: 62,604,068	L170P	probably damaging	Het
Grik4	A	T	9: 42,542,005	Y695N	probably benign	Het
Gsg1	A	T	6: 135,240,145	V228D	probably damaging	Het
Helb	G	A	10: 120,105,448	T445M	probably benign	Het
Helz2	A	T	2: 181,233,732	D1656E	probably damaging	Het
Hyou1	A	T	9: 44,388,019	K669M	probably benign	Het
Itga2	T	C	13: 114,849,381	N953D	possibly damaging	Het
Ldhd	T	C	8: 111,629,386	I122V	probably benign	Het
Lrrtm1	A	G	6: 77,244,346	D262G	probably damaging	Het
Mapkapk5	T	C	5: 121,535,864		probably null	Het
Numa1	T	C	7: 101,999,990	I976T	probably benign	Het
Olfr1307	A	G	2: 111,945,003	V151A	probably benign	Het
Olfr417	A	G	1: 174,369,401	I161M	probably damaging	Het
Olfr446	C	T	6: 42,927,525	T98I	probably benign	Het
Olfr677	T	C	7: 105,056,885	I213T	probably benign	Het
Patj	G	A	4: 98,523,502		probably null	Het
Pfas	T	C	11: 68,992,187	D757G	possibly damaging	Het
Pom121l2	A	G	13: 21,981,975	N139D	probably benign	Het
Ppp2r3a	A	T	9: 101,127,015	Y994*	probably null	Het
Ppp6c	T	C	2: 39,197,513	D227G	probably benign	Het
Ptpn13	T	G	5: 103,569,558	H1855Q	probably damaging	Het
Ptprh	T	A	7: 4,601,868	Q59L	probably benign	Het
Rap1gap2	T	C	11: 74,393,146	K669E	probably benign	Het
Rbl2	T	C	8: 91,090,055	S348P	possibly damaging	Het
Rptor	T	A	11: 119,725,144	N161K	probably damaging	Het
Satb1	C	T	17: 51,803,496	A192T	probably damaging	Het
Scn5a	A	G	9: 119,516,051	V1083A	probably benign	Het
Sec14l2	C	T	11: 4,108,964	A194T	probably damaging	Het
Sema4b	A	G	7: 80,212,835	N53S	probably benign	Het
Sin3b	T	A	8: 72,753,295	Y876*	probably null	Het
Smchd1	C	A	17: 71,463,799	M129I	probably benign	Het
Tmc1	T	C	19: 20,824,084	Y484C	probably damaging	Het
Utp20	A	G	10: 88,820,939	S135P	probably damaging	Het
Zfp266	A	T	9: 20,499,679	C401S	probably damaging	Het
Zfp738	G	A	13: 67,671,194	T226I	probably damaging	Het
Zfp871	G	A	17: 32,775,301	T300M	probably damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
R9455:Adamts5	UTSW	16	85870129	missense	probably damaging	0.99
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTATTGCAGCTGTTACAAG -3'
(R):5'- CAGGCTATAACCGTGGCTTC -3'

Sequencing Primer
(F):5'- CCTATTGCAGCTGTTACAAGTGTTTG -3'
(R):5'- GTAGCTCAGAAGAGTTCCTGC -3'

Posted On

2014-10-02