Mutagenetix > Incidental Mutation

Incidental Mutation 'R2180:Tmc1'

237165

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

040182-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R2180 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20824084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 484 (Y484C)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: Y484C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: Y484C

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	A	4: 41,507,170	M209L	probably benign	Het
Adamts5	T	C	16: 85,887,924	D377G	probably damaging	Het
Adgrl4	A	T	3: 151,500,142	I164F	probably damaging	Het
Anxa9	T	C	3: 95,306,424		probably null	Het
Aox4	A	T	1: 58,213,067	T34S	probably benign	Het
Asic1	G	T	15: 99,671,965	V56F	probably benign	Het
Atpaf1	T	C	4: 115,788,360	M1T	probably null	Het
Axin1	A	G	17: 26,143,335	T218A	probably benign	Het
BC049762	C	A	11: 51,254,610	W50L	probably damaging	Het
Bdp1	ATTCTTCTTCTTCTTCTTC	ATTCTTCTTCTTCTTCTTCTTC	13: 100,061,405		probably benign	Het
Birc6	T	C	17: 74,612,151	I1988T	probably benign	Het
Btbd7	A	T	12: 102,785,897	D869E	probably damaging	Het
Caln1	T	C	5: 130,839,408	*220Q	probably null	Het
Ccdc150	G	A	1: 54,272,547		probably null	Het
Ccnt1	A	T	15: 98,543,600	S596T	possibly damaging	Het
Cd44	C	T	2: 102,828,610	G640E	possibly damaging	Het
Cep192	A	G	18: 67,824,742	E582G	possibly damaging	Het
Clcnkb	G	T	4: 141,409,508		probably null	Het
Dhx29	T	C	13: 112,962,872		probably null	Het
Dnah8	T	C	17: 30,840,647	F4407S	probably benign	Het
Enah	A	T	1: 181,918,459	M419K	probably damaging	Het
Fam129a	A	T	1: 151,718,078	H838L	probably benign	Het
Fancd2	A	T	6: 113,574,637	T1055S	probably benign	Het
Gigyf2	G	A	1: 87,416,920	G525D	probably damaging	Het
Gm5800	T	A	14: 51,715,994	K55*	probably null	Het
Gpr149	A	G	3: 62,604,068	L170P	probably damaging	Het
Grik4	A	T	9: 42,542,005	Y695N	probably benign	Het
Gsg1	A	T	6: 135,240,145	V228D	probably damaging	Het
Helb	G	A	10: 120,105,448	T445M	probably benign	Het
Helz2	A	T	2: 181,233,732	D1656E	probably damaging	Het
Hyou1	A	T	9: 44,388,019	K669M	probably benign	Het
Itga2	T	C	13: 114,849,381	N953D	possibly damaging	Het
Ldhd	T	C	8: 111,629,386	I122V	probably benign	Het
Lrrtm1	A	G	6: 77,244,346	D262G	probably damaging	Het
Mapkapk5	T	C	5: 121,535,864		probably null	Het
Numa1	T	C	7: 101,999,990	I976T	probably benign	Het
Olfr1307	A	G	2: 111,945,003	V151A	probably benign	Het
Olfr417	A	G	1: 174,369,401	I161M	probably damaging	Het
Olfr446	C	T	6: 42,927,525	T98I	probably benign	Het
Olfr677	T	C	7: 105,056,885	I213T	probably benign	Het
Patj	G	A	4: 98,523,502		probably null	Het
Pfas	T	C	11: 68,992,187	D757G	possibly damaging	Het
Pom121l2	A	G	13: 21,981,975	N139D	probably benign	Het
Ppp2r3a	A	T	9: 101,127,015	Y994*	probably null	Het
Ppp6c	T	C	2: 39,197,513	D227G	probably benign	Het
Ptpn13	T	G	5: 103,569,558	H1855Q	probably damaging	Het
Ptprh	T	A	7: 4,601,868	Q59L	probably benign	Het
Rap1gap2	T	C	11: 74,393,146	K669E	probably benign	Het
Rbl2	T	C	8: 91,090,055	S348P	possibly damaging	Het
Rptor	T	A	11: 119,725,144	N161K	probably damaging	Het
Satb1	C	T	17: 51,803,496	A192T	probably damaging	Het
Scn5a	A	G	9: 119,516,051	V1083A	probably benign	Het
Sec14l2	C	T	11: 4,108,964	A194T	probably damaging	Het
Sema4b	A	G	7: 80,212,835	N53S	probably benign	Het
Sin3b	T	A	8: 72,753,295	Y876*	probably null	Het
Smchd1	C	A	17: 71,463,799	M129I	probably benign	Het
Utp20	A	G	10: 88,820,939	S135P	probably damaging	Het
Zfp266	A	T	9: 20,499,679	C401S	probably damaging	Het
Zfp738	G	A	13: 67,671,194	T226I	probably damaging	Het
Zfp871	G	A	17: 32,775,301	T300M	probably damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R9493:Tmc1	UTSW	19	20824280	missense	probably benign	0.00
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTAAATCTTCAGCAAACAGC -3'
(R):5'- ACAACAAGGTGAGTCTAGGGTC -3'

Sequencing Primer
(F):5'- ACCATTGTTTCCCAGCAG -3'
(R):5'- CTTGATTGTCCTTGTCATCAGTG -3'

Posted On

2014-10-02