Incidental Mutation 'R2181:Nbeal1'
ID 237166
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 040183-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2181 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 60219758-60377487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60317939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1959 (F1959L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000162291]
AlphaFold E9PYP2
Predicted Effect unknown
Transcript: ENSMUST00000035569
AA Change: F692L
SMART Domains Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: F692L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
Pfam:DUF4704 851 1130 3.4e-39 PFAM
low complexity region 1383 1401 N/A INTRINSIC
Pfam:DUF4800 1575 1828 6.3e-126 PFAM
coiled coil region 1859 1882 N/A INTRINSIC
Pfam:PH_BEACH 1889 1975 2e-24 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159344
AA Change: F4L
SMART Domains Protein: ENSMUSP00000124850
Gene: ENSMUSG00000073664
AA Change: F4L

DomainStartEndE-ValueType
Beach 31 246 4.21e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160834
AA Change: F1959L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: F1959L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162291
AA Change: F690L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125592
Gene: ENSMUSG00000073664
AA Change: F690L

DomainStartEndE-ValueType
low complexity region 114 132 N/A INTRINSIC
low complexity region 580 596 N/A INTRINSIC
Pfam:PH_BEACH 613 706 9.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188450
Meta Mutation Damage Score 0.5617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,724,950 (GRCm39) S43N possibly damaging Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Adgra2 G A 8: 27,611,701 (GRCm39) G1002S probably damaging Het
Arhgap28 T C 17: 68,203,112 (GRCm39) T114A probably damaging Het
Colec12 T A 18: 9,846,828 (GRCm39) S75T probably damaging Het
Cyp2c67 A G 19: 39,597,541 (GRCm39) C486R possibly damaging Het
Ecm2 T A 13: 49,683,765 (GRCm39) L581Q probably damaging Het
Faxc T A 4: 21,931,591 (GRCm39) S10T probably benign Het
Frem2 A G 3: 53,482,008 (GRCm39) I1893T possibly damaging Het
Gabrr3 T A 16: 59,268,372 (GRCm39) D328E probably damaging Het
Gbp7 A G 3: 142,249,791 (GRCm39) I421V possibly damaging Het
Gorasp1 A G 9: 119,757,422 (GRCm39) S317P probably damaging Het
Htr6 A G 4: 138,801,736 (GRCm39) S113P probably damaging Het
Ift74 A G 4: 94,520,951 (GRCm39) E168G probably damaging Het
Kdm6b A T 11: 69,291,952 (GRCm39) Y1443* probably null Het
Mmp28 A C 11: 83,333,543 (GRCm39) V466G possibly damaging Het
Nbea A T 3: 55,937,360 (GRCm39) S750R possibly damaging Het
Nelfa T C 5: 34,057,853 (GRCm39) N314D probably benign Het
Numbl T A 7: 26,968,346 (GRCm39) probably null Het
Or13c25 T A 4: 52,911,524 (GRCm39) K90M probably damaging Het
Or1j17 G A 2: 36,578,346 (GRCm39) D111N probably damaging Het
Or2p2 G T 13: 21,257,394 (GRCm39) P26T probably damaging Het
Or52e5 T C 7: 104,719,418 (GRCm39) V248A possibly damaging Het
Or5b113 G T 19: 13,342,438 (GRCm39) V149F probably benign Het
Penk T C 4: 4,134,041 (GRCm39) probably null Het
Pglyrp2 A G 17: 32,637,936 (GRCm39) S31P probably damaging Het
Pigg T C 5: 108,484,366 (GRCm39) S538P probably damaging Het
Pld2 A G 11: 70,433,815 (GRCm39) T252A possibly damaging Het
Ppp2r5e T C 12: 75,509,098 (GRCm39) I394V probably benign Het
Sh3rf1 G T 8: 61,816,272 (GRCm39) V510F probably damaging Het
Slc4a2 A G 5: 24,640,651 (GRCm39) H677R possibly damaging Het
Stam2 A T 2: 52,593,156 (GRCm39) H345Q probably benign Het
Tmtc3 T C 10: 100,284,835 (GRCm39) N600S probably benign Het
Trappc8 A G 18: 20,952,279 (GRCm39) probably null Het
Vmn1r72 A T 7: 11,403,595 (GRCm39) C284* probably null Het
Vmn2r76 T C 7: 85,874,743 (GRCm39) I745V probably benign Het
Zfhx4 A C 3: 5,468,392 (GRCm39) D2850A probably damaging Het
Zfp764 A G 7: 127,005,671 (GRCm39) W36R probably damaging Het
Zfp804b G A 5: 6,821,674 (GRCm39) T463I probably damaging Het
Zfp811 T G 17: 33,016,695 (GRCm39) K448N probably damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60,274,350 (GRCm39) nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60,321,042 (GRCm39) missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60,367,262 (GRCm39) missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60,256,384 (GRCm39) missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60,220,900 (GRCm39) missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60,234,170 (GRCm39) critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60,234,302 (GRCm39) missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60,274,512 (GRCm39) missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60,320,500 (GRCm39) missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60,281,784 (GRCm39) critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60,269,787 (GRCm39) missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60,281,784 (GRCm39) critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60,256,414 (GRCm39) missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60,281,694 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60,311,418 (GRCm39) critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60,292,660 (GRCm39) missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60,368,494 (GRCm39) missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60,274,396 (GRCm39) missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60,323,146 (GRCm39) missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60,326,603 (GRCm39) splice site probably benign
IGL02945:Nbeal1 APN 1 60,245,569 (GRCm39) missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60,292,572 (GRCm39) missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60,317,886 (GRCm39) missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60,275,618 (GRCm39) missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60,274,027 (GRCm39) missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60,274,028 (GRCm39) missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60,300,745 (GRCm39) critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60,281,726 (GRCm39) nonsense probably null
coach UTSW 1 60,292,640 (GRCm39) nonsense probably null
Committee UTSW 1 60,332,062 (GRCm39) missense probably damaging 1.00
Disgrace UTSW 1 60,320,469 (GRCm39) nonsense probably null
Dravrah UTSW 1 60,323,251 (GRCm39) missense probably damaging 1.00
Harvard UTSW 1 60,274,722 (GRCm39) splice site probably null
horrified UTSW 1 60,283,983 (GRCm39) missense probably damaging 1.00
Lampoon UTSW 1 60,300,745 (GRCm39) critical splice donor site probably null
lawyer UTSW 1 60,349,383 (GRCm39) nonsense probably null
magistrate UTSW 1 60,233,756 (GRCm39) critical splice donor site probably null
Maratimus UTSW 1 60,331,047 (GRCm39) missense probably damaging 1.00
National UTSW 1 60,261,422 (GRCm39) missense possibly damaging 0.95
phainopepla UTSW 1 60,358,846 (GRCm39) missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60,233,758 (GRCm39) splice site probably benign
satirical UTSW 1 60,274,721 (GRCm39) critical splice donor site probably null
silky UTSW 1 60,370,037 (GRCm39) splice site probably benign
stiggs UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60,303,431 (GRCm39) splice site probably benign
P0007:Nbeal1 UTSW 1 60,358,847 (GRCm39) missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60,331,096 (GRCm39) missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60,321,030 (GRCm39) missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60,349,422 (GRCm39) missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60,267,771 (GRCm39) splice site probably benign
R0054:Nbeal1 UTSW 1 60,326,560 (GRCm39) utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60,286,876 (GRCm39) missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60,286,876 (GRCm39) missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60,344,468 (GRCm39) missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60,344,529 (GRCm39) splice site probably benign
R0324:Nbeal1 UTSW 1 60,332,032 (GRCm39) missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60,307,222 (GRCm39) missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60,307,222 (GRCm39) missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60,286,893 (GRCm39) missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60,307,598 (GRCm39) missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60,320,991 (GRCm39) nonsense probably null
R1034:Nbeal1 UTSW 1 60,329,165 (GRCm39) nonsense probably null
R1082:Nbeal1 UTSW 1 60,351,385 (GRCm39) missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60,299,428 (GRCm39) missense probably benign
R1187:Nbeal1 UTSW 1 60,233,687 (GRCm39) missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60,240,098 (GRCm39) missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60,344,450 (GRCm39) missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60,239,278 (GRCm39) missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60,299,493 (GRCm39) missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60,323,251 (GRCm39) missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60,307,100 (GRCm39) nonsense probably null
R1952:Nbeal1 UTSW 1 60,273,999 (GRCm39) missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60,273,999 (GRCm39) missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60,245,503 (GRCm39) missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60,358,846 (GRCm39) missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60,332,123 (GRCm39) splice site probably null
R2055:Nbeal1 UTSW 1 60,350,216 (GRCm39) missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60,309,515 (GRCm39) missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60,344,430 (GRCm39) splice site probably null
R2192:Nbeal1 UTSW 1 60,321,054 (GRCm39) missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60,323,165 (GRCm39) missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60,370,037 (GRCm39) splice site probably benign
R2268:Nbeal1 UTSW 1 60,370,037 (GRCm39) splice site probably benign
R2351:Nbeal1 UTSW 1 60,276,257 (GRCm39) missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60,290,511 (GRCm39) missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60,290,529 (GRCm39) missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60,317,939 (GRCm39) missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60,290,572 (GRCm39) splice site probably benign
R3747:Nbeal1 UTSW 1 60,234,182 (GRCm39) missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60,233,758 (GRCm39) splice site probably benign
R4119:Nbeal1 UTSW 1 60,331,029 (GRCm39) missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60,370,107 (GRCm39) missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60,329,105 (GRCm39) missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60,306,933 (GRCm39) missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60,320,469 (GRCm39) nonsense probably null
R4618:Nbeal1 UTSW 1 60,267,890 (GRCm39) intron probably benign
R4673:Nbeal1 UTSW 1 60,368,549 (GRCm39) missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60,274,722 (GRCm39) splice site probably null
R4798:Nbeal1 UTSW 1 60,261,352 (GRCm39) splice site probably null
R4826:Nbeal1 UTSW 1 60,290,501 (GRCm39) missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60,292,534 (GRCm39) missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60,292,534 (GRCm39) missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60,332,062 (GRCm39) missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60,277,813 (GRCm39) missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60,276,338 (GRCm39) missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60,309,487 (GRCm39) missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60,274,718 (GRCm39) nonsense probably null
R5345:Nbeal1 UTSW 1 60,367,369 (GRCm39) critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60,350,158 (GRCm39) missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60,316,353 (GRCm39) missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60,276,311 (GRCm39) missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60,281,761 (GRCm39) missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60,331,006 (GRCm39) missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60,311,380 (GRCm39) missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60,267,950 (GRCm39) intron probably benign
R5918:Nbeal1 UTSW 1 60,307,051 (GRCm39) missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60,287,554 (GRCm39) missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60,287,564 (GRCm39) missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60,220,715 (GRCm39) start gained probably benign
R6113:Nbeal1 UTSW 1 60,261,422 (GRCm39) missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60,290,466 (GRCm39) missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60,296,643 (GRCm39) missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60,261,287 (GRCm39) missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60,335,083 (GRCm39) missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60,287,524 (GRCm39) missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60,277,878 (GRCm39) missense probably benign
R6457:Nbeal1 UTSW 1 60,292,633 (GRCm39) missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60,370,101 (GRCm39) missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60,320,469 (GRCm39) nonsense probably null
R7021:Nbeal1 UTSW 1 60,300,745 (GRCm39) critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60,350,106 (GRCm39) missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60,299,793 (GRCm39) nonsense probably null
R7157:Nbeal1 UTSW 1 60,276,317 (GRCm39) missense probably damaging 1.00
R7209:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60,240,110 (GRCm39) missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60,349,383 (GRCm39) nonsense probably null
R7312:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60,256,355 (GRCm39) missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60,283,969 (GRCm39) missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60,233,756 (GRCm39) critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60,300,743 (GRCm39) missense probably benign
R7507:Nbeal1 UTSW 1 60,274,626 (GRCm39) missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60,316,386 (GRCm39) missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60,283,983 (GRCm39) missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60,296,609 (GRCm39) missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60,358,500 (GRCm39) missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60,331,048 (GRCm39) missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60,299,591 (GRCm39) missense probably benign
R7902:Nbeal1 UTSW 1 60,331,029 (GRCm39) missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60,299,431 (GRCm39) nonsense probably null
R8053:Nbeal1 UTSW 1 60,318,954 (GRCm39) missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60,239,292 (GRCm39) missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60,276,310 (GRCm39) missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60,292,640 (GRCm39) nonsense probably null
R8209:Nbeal1 UTSW 1 60,316,336 (GRCm39) missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60,316,336 (GRCm39) missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60,274,721 (GRCm39) critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60,274,316 (GRCm39) missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60,307,542 (GRCm39) missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60,274,370 (GRCm39) missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60,300,743 (GRCm39) missense probably benign
R8952:Nbeal1 UTSW 1 60,299,459 (GRCm39) missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60,329,118 (GRCm39) missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60,317,885 (GRCm39) missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60,307,548 (GRCm39) missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60,286,904 (GRCm39) nonsense probably null
R9168:Nbeal1 UTSW 1 60,331,047 (GRCm39) missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60,320,425 (GRCm39) missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60,317,839 (GRCm39) missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60,307,548 (GRCm39) missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60,297,818 (GRCm39) missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60,349,424 (GRCm39) missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60,290,287 (GRCm39) nonsense probably null
R9557:Nbeal1 UTSW 1 60,274,509 (GRCm39) missense probably benign
R9560:Nbeal1 UTSW 1 60,368,544 (GRCm39) missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60,350,247 (GRCm39) missense probably damaging 1.00
R9784:Nbeal1 UTSW 1 60,299,741 (GRCm39) nonsense probably null
X0022:Nbeal1 UTSW 1 60,316,391 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGAGATATTTTCTTCCTGGAGTG -3'
(R):5'- GTTCTACGGTATGTACACACTCAC -3'

Sequencing Primer
(F):5'- GAGTGAGTAACTTTATGTGGCAC -3'
(R):5'- GGTATGTACACACTCACTGGAAAC -3'
Posted On 2014-10-02