Mutagenetix > Incidental Mutations

Incidental Mutation 'R2181:Ecm2'

237201

Institutional Source

Beutler Lab

Gene Symbol

Ecm2

Ensembl Gene

ENSMUSG00000043631

Gene Name

extracellular matrix protein 2, female organ and adipocyte specific

Synonyms

tenonectin, 9030618O22Rik

MMRRC Submission

040183-MU

Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R2181 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49504810-49532789 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49530289 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 581 (L581Q)

Ref Sequence

ENSEMBL: ENSMUSP00000060402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]

Predicted Effect

probably benign
Transcript: ENSMUST00000021818

SMART Domains

Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

Domain	Start	End	E-Value	Type
coiled coil region	1	34	N/A	INTRINSIC
Pfam:CENP-P	102	278	3.9e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000051504
AA Change: L581Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: L581Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	21	36	N/A	INTRINSIC
VWC	98	152	1.37e-11	SMART
coiled coil region	235	269	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
LRR	314	336	1.41e2	SMART
LRR	337	362	1.76e-1	SMART
LRR	363	386	5.41e0	SMART
LRR	408	433	1.91e1	SMART
LRR	434	457	4.98e-1	SMART
LRR	459	478	8.03e1	SMART
LRR	506	528	2.76e1	SMART
LRR	529	549	1.19e2	SMART
LRR	578	600	1.81e1	SMART
LRR	601	624	9.48e0	SMART
LRR	631	655	6.06e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222592

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	C	T	16: 3,907,086	S43N	possibly damaging	Het
Abcb5	T	G	12: 118,867,946	I1224L	possibly damaging	Het
Adgra2	G	A	8: 27,121,673	G1002S	probably damaging	Het
Arhgap28	T	C	17: 67,896,117	T114A	probably damaging	Het
Colec12	T	A	18: 9,846,828	S75T	probably damaging	Het
Cyp2c67	A	G	19: 39,609,097	C486R	possibly damaging	Het
Faxc	T	A	4: 21,931,591	S10T	probably benign	Het
Frem2	A	G	3: 53,574,587	I1893T	possibly damaging	Het
Gabrr3	T	A	16: 59,448,009	D328E	probably damaging	Het
Gbp7	A	G	3: 142,544,030	I421V	possibly damaging	Het
Gorasp1	A	G	9: 119,928,356	S317P	probably damaging	Het
Htr6	A	G	4: 139,074,425	S113P	probably damaging	Het
Ift74	A	G	4: 94,632,714	E168G	probably damaging	Het
Kdm6b	A	T	11: 69,401,126	Y1443*	probably null	Het
Mmp28	A	C	11: 83,442,717	V466G	possibly damaging	Het
Nbea	A	T	3: 56,029,939	S750R	possibly damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Nelfa	T	C	5: 33,900,509	N314D	probably benign	Het
Numbl	T	A	7: 27,268,921		probably null	Het
Olfr1370	G	T	13: 21,073,224	P26T	probably damaging	Het
Olfr1467	G	T	19: 13,365,074	V149F	probably benign	Het
Olfr272	T	A	4: 52,911,524	K90M	probably damaging	Het
Olfr346	G	A	2: 36,688,334	D111N	probably damaging	Het
Olfr678	T	C	7: 105,070,211	V248A	possibly damaging	Het
Penk	T	C	4: 4,134,041		probably null	Het
Pglyrp2	A	G	17: 32,418,962	S31P	probably damaging	Het
Pigg	T	C	5: 108,336,500	S538P	probably damaging	Het
Pld2	A	G	11: 70,542,989	T252A	possibly damaging	Het
Ppp2r5e	T	C	12: 75,462,324	I394V	probably benign	Het
Sh3rf1	G	T	8: 61,363,238	V510F	probably damaging	Het
Slc4a2	A	G	5: 24,435,653	H677R	possibly damaging	Het
Stam2	A	T	2: 52,703,144	H345Q	probably benign	Het
Tmtc3	T	C	10: 100,448,973	N600S	probably benign	Het
Trappc8	A	G	18: 20,819,222		probably null	Het
Vmn1r72	A	T	7: 11,669,668	C284*	probably null	Het
Vmn2r76	T	C	7: 86,225,535	I745V	probably benign	Het
Zfhx4	A	C	3: 5,403,332	D2850A	probably damaging	Het
Zfp764	A	G	7: 127,406,499	W36R	probably damaging	Het
Zfp804b	G	A	5: 6,771,674	T463I	probably damaging	Het
Zfp811	T	G	17: 32,797,721	K448N	probably damaging	Het

Other mutations in Ecm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00677:Ecm2	APN	13	49531318	missense	probably benign	0.14
IGL01685:Ecm2	APN	13	49528898	missense	probably damaging	1.00
IGL02070:Ecm2	APN	13	49518370	missense	probably damaging	1.00
IGL02108:Ecm2	APN	13	49518444	nonsense	probably null
IGL02138:Ecm2	APN	13	49522828	missense	probably damaging	1.00
IGL02937:Ecm2	APN	13	49518476	missense	probably damaging	0.99
IGL03350:Ecm2	APN	13	49520944	missense	probably benign
R0049:Ecm2	UTSW	13	49524446	nonsense	probably null
R0049:Ecm2	UTSW	13	49524446	nonsense	probably null
R0627:Ecm2	UTSW	13	49521083	splice site	probably benign
R1515:Ecm2	UTSW	13	49518332	missense	possibly damaging	0.87
R1864:Ecm2	UTSW	13	49530145	missense	probably benign	0.28
R1865:Ecm2	UTSW	13	49530145	missense	probably benign	0.28
R1991:Ecm2	UTSW	13	49530256	missense	probably benign	0.28
R2103:Ecm2	UTSW	13	49530256	missense	probably benign	0.28
R2209:Ecm2	UTSW	13	49530156	missense	probably damaging	1.00
R2568:Ecm2	UTSW	13	49530129	missense	possibly damaging	0.81
R4856:Ecm2	UTSW	13	49522787	missense	possibly damaging	0.47
R4867:Ecm2	UTSW	13	49531345	missense	probably damaging	0.99
R4886:Ecm2	UTSW	13	49522787	missense	possibly damaging	0.47
R5368:Ecm2	UTSW	13	49520943	missense	probably benign
R5420:Ecm2	UTSW	13	49527734	missense	possibly damaging	0.65
R6084:Ecm2	UTSW	13	49515094	nonsense	probably null
R6244:Ecm2	UTSW	13	49530307	missense	probably damaging	1.00
R6881:Ecm2	UTSW	13	49530342	nonsense	probably null
R6931:Ecm2	UTSW	13	49529011	missense	probably benign	0.00
R7085:Ecm2	UTSW	13	49520902	missense	probably damaging	1.00
R7347:Ecm2	UTSW	13	49515078	missense	probably damaging	0.99
R7490:Ecm2	UTSW	13	49530342	nonsense	probably null
R8039:Ecm2	UTSW	13	49514850

Predicted Primers

PCR Primer
(F):5'- CCTGAGGTTCCTTATGCTGC -3'
(R):5'- ACTCTGCAGGTCACTTTCTG -3'

Sequencing Primer
(F):5'- ATTGACCTGTCCTATAACAAGCTC -3'
(R):5'- GCAGGTCACTTTCTGTATTACATG -3'

Posted On

2014-10-02