Incidental Mutation 'R2181:Ecm2'
ID237201
Institutional Source Beutler Lab
Gene Symbol Ecm2
Ensembl Gene ENSMUSG00000043631
Gene Nameextracellular matrix protein 2, female organ and adipocyte specific
Synonymstenonectin, 9030618O22Rik
MMRRC Submission 040183-MU
Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49504810-49532789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49530289 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 581 (L581Q)
Ref Sequence ENSEMBL: ENSMUSP00000060402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051504
AA Change: L581Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: L581Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
VWC 98 152 1.37e-11 SMART
coiled coil region 235 269 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
LRR 314 336 1.41e2 SMART
LRR 337 362 1.76e-1 SMART
LRR 363 386 5.41e0 SMART
LRR 408 433 1.91e1 SMART
LRR 434 457 4.98e-1 SMART
LRR 459 478 8.03e1 SMART
LRR 506 528 2.76e1 SMART
LRR 529 549 1.19e2 SMART
LRR 578 600 1.81e1 SMART
LRR 601 624 9.48e0 SMART
LRR 631 655 6.06e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222592
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,907,086 S43N possibly damaging Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in Ecm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Ecm2 APN 13 49531318 missense probably benign 0.14
IGL01685:Ecm2 APN 13 49528898 missense probably damaging 1.00
IGL02070:Ecm2 APN 13 49518370 missense probably damaging 1.00
IGL02108:Ecm2 APN 13 49518444 nonsense probably null
IGL02138:Ecm2 APN 13 49522828 missense probably damaging 1.00
IGL02937:Ecm2 APN 13 49518476 missense probably damaging 0.99
IGL03350:Ecm2 APN 13 49520944 missense probably benign
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0627:Ecm2 UTSW 13 49521083 splice site probably benign
R1515:Ecm2 UTSW 13 49518332 missense possibly damaging 0.87
R1864:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1865:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1991:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2103:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2209:Ecm2 UTSW 13 49530156 missense probably damaging 1.00
R2568:Ecm2 UTSW 13 49530129 missense possibly damaging 0.81
R4856:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R4867:Ecm2 UTSW 13 49531345 missense probably damaging 0.99
R4886:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R5368:Ecm2 UTSW 13 49520943 missense probably benign
R5420:Ecm2 UTSW 13 49527734 missense possibly damaging 0.65
R6084:Ecm2 UTSW 13 49515094 nonsense probably null
R6244:Ecm2 UTSW 13 49530307 missense probably damaging 1.00
R6881:Ecm2 UTSW 13 49530342 nonsense probably null
R6931:Ecm2 UTSW 13 49529011 missense probably benign 0.00
R7085:Ecm2 UTSW 13 49520902 missense probably damaging 1.00
R7347:Ecm2 UTSW 13 49515078 missense probably damaging 0.99
R7490:Ecm2 UTSW 13 49530342 nonsense probably null
R8039:Ecm2 UTSW 13 49514850
Predicted Primers PCR Primer
(F):5'- CCTGAGGTTCCTTATGCTGC -3'
(R):5'- ACTCTGCAGGTCACTTTCTG -3'

Sequencing Primer
(F):5'- ATTGACCTGTCCTATAACAAGCTC -3'
(R):5'- GCAGGTCACTTTCTGTATTACATG -3'
Posted On2014-10-02