Incidental Mutation 'R2181:Cyp2c67'
ID 237213
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
MMRRC Submission 040183-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R2181 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 39597288-39637497 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39597541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 486 (C486R)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect possibly damaging
Transcript: ENSMUST00000067328
AA Change: C486R

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: C486R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik C T 16: 3,724,950 (GRCm39) S43N possibly damaging Het
Abcb5 T G 12: 118,831,681 (GRCm39) I1224L possibly damaging Het
Adgra2 G A 8: 27,611,701 (GRCm39) G1002S probably damaging Het
Arhgap28 T C 17: 68,203,112 (GRCm39) T114A probably damaging Het
Colec12 T A 18: 9,846,828 (GRCm39) S75T probably damaging Het
Ecm2 T A 13: 49,683,765 (GRCm39) L581Q probably damaging Het
Faxc T A 4: 21,931,591 (GRCm39) S10T probably benign Het
Frem2 A G 3: 53,482,008 (GRCm39) I1893T possibly damaging Het
Gabrr3 T A 16: 59,268,372 (GRCm39) D328E probably damaging Het
Gbp7 A G 3: 142,249,791 (GRCm39) I421V possibly damaging Het
Gorasp1 A G 9: 119,757,422 (GRCm39) S317P probably damaging Het
Htr6 A G 4: 138,801,736 (GRCm39) S113P probably damaging Het
Ift74 A G 4: 94,520,951 (GRCm39) E168G probably damaging Het
Kdm6b A T 11: 69,291,952 (GRCm39) Y1443* probably null Het
Mmp28 A C 11: 83,333,543 (GRCm39) V466G possibly damaging Het
Nbea A T 3: 55,937,360 (GRCm39) S750R possibly damaging Het
Nbeal1 T C 1: 60,317,939 (GRCm39) F1959L probably damaging Het
Nelfa T C 5: 34,057,853 (GRCm39) N314D probably benign Het
Numbl T A 7: 26,968,346 (GRCm39) probably null Het
Or13c25 T A 4: 52,911,524 (GRCm39) K90M probably damaging Het
Or1j17 G A 2: 36,578,346 (GRCm39) D111N probably damaging Het
Or2p2 G T 13: 21,257,394 (GRCm39) P26T probably damaging Het
Or52e5 T C 7: 104,719,418 (GRCm39) V248A possibly damaging Het
Or5b113 G T 19: 13,342,438 (GRCm39) V149F probably benign Het
Penk T C 4: 4,134,041 (GRCm39) probably null Het
Pglyrp2 A G 17: 32,637,936 (GRCm39) S31P probably damaging Het
Pigg T C 5: 108,484,366 (GRCm39) S538P probably damaging Het
Pld2 A G 11: 70,433,815 (GRCm39) T252A possibly damaging Het
Ppp2r5e T C 12: 75,509,098 (GRCm39) I394V probably benign Het
Sh3rf1 G T 8: 61,816,272 (GRCm39) V510F probably damaging Het
Slc4a2 A G 5: 24,640,651 (GRCm39) H677R possibly damaging Het
Stam2 A T 2: 52,593,156 (GRCm39) H345Q probably benign Het
Tmtc3 T C 10: 100,284,835 (GRCm39) N600S probably benign Het
Trappc8 A G 18: 20,952,279 (GRCm39) probably null Het
Vmn1r72 A T 7: 11,403,595 (GRCm39) C284* probably null Het
Vmn2r76 T C 7: 85,874,743 (GRCm39) I745V probably benign Het
Zfhx4 A C 3: 5,468,392 (GRCm39) D2850A probably damaging Het
Zfp764 A G 7: 127,005,671 (GRCm39) W36R probably damaging Het
Zfp804b G A 5: 6,821,674 (GRCm39) T463I probably damaging Het
Zfp811 T G 17: 33,016,695 (GRCm39) K448N probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39,631,829 (GRCm39) missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39,628,376 (GRCm39) nonsense probably null
IGL01363:Cyp2c67 APN 19 39,628,411 (GRCm39) missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39,604,165 (GRCm39) missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39,637,470 (GRCm39) missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39,637,446 (GRCm39) missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02355:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02358:Cyp2c67 APN 19 39,605,861 (GRCm39) missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39,605,826 (GRCm39) nonsense probably null
IGL02362:Cyp2c67 APN 19 39,631,849 (GRCm39) missense probably benign 0.34
IGL02388:Cyp2c67 APN 19 39,631,799 (GRCm39) missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39,632,119 (GRCm39) missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39,631,738 (GRCm39) missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39,631,713 (GRCm39) critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39,632,128 (GRCm39) missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39,628,405 (GRCm39) missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39,637,329 (GRCm39) missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39,627,138 (GRCm39) missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39,597,622 (GRCm39) missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39,631,818 (GRCm39) missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39,614,585 (GRCm39) missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39,627,069 (GRCm39) missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39,627,035 (GRCm39) missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39,637,408 (GRCm39) missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1613:Cyp2c67 UTSW 19 39,614,643 (GRCm39) missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39,631,708 (GRCm39) splice site probably benign
R1667:Cyp2c67 UTSW 19 39,632,034 (GRCm39) critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39,605,811 (GRCm39) missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39,631,789 (GRCm39) missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39,614,681 (GRCm39) missense probably benign 0.24
R3817:Cyp2c67 UTSW 19 39,627,127 (GRCm39) missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39,632,098 (GRCm39) missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39,627,032 (GRCm39) missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39,632,188 (GRCm39) missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39,604,168 (GRCm39) missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39,627,132 (GRCm39) missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39,614,676 (GRCm39) missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39,604,094 (GRCm39) missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39,605,879 (GRCm39) missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39,605,873 (GRCm39) missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39,605,854 (GRCm39) nonsense probably null
R6939:Cyp2c67 UTSW 19 39,631,778 (GRCm39) missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39,604,123 (GRCm39) missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39,628,341 (GRCm39) missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39,604,138 (GRCm39) missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39,605,783 (GRCm39) missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39,628,451 (GRCm39) nonsense probably null
R7337:Cyp2c67 UTSW 19 39,597,708 (GRCm39) splice site probably null
R7474:Cyp2c67 UTSW 19 39,605,876 (GRCm39) missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39,604,084 (GRCm39) missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39,597,669 (GRCm39) missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39,628,452 (GRCm39) missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39,627,118 (GRCm39) missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39,627,155 (GRCm39) missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39,614,605 (GRCm39) missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39,597,699 (GRCm39) missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39,627,178 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39,632,123 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AATAGAGAACTGTTAGCCTTGGG -3'
(R):5'- CTCAAACTCACTTATGTACGAGAC -3'

Sequencing Primer
(F):5'- CCTTGGGCAATTAGAGAACAGAAGC -3'
(R):5'- GTACGAGACATAGTTACCTTCTTTC -3'
Posted On 2014-10-02