Mutagenetix > Incidental Mutations

Incidental Mutation 'R2181:Cyp2c67'

237213

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

040183-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2181 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39609097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 486 (C486R)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

AlphaFold

Q569X9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067328
AA Change: C486R

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: C486R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	C	T	16: 3,907,086	S43N	possibly damaging	Het
Abcb5	T	G	12: 118,867,946	I1224L	possibly damaging	Het
Adgra2	G	A	8: 27,121,673	G1002S	probably damaging	Het
Arhgap28	T	C	17: 67,896,117	T114A	probably damaging	Het
Colec12	T	A	18: 9,846,828	S75T	probably damaging	Het
Ecm2	T	A	13: 49,530,289	L581Q	probably damaging	Het
Faxc	T	A	4: 21,931,591	S10T	probably benign	Het
Frem2	A	G	3: 53,574,587	I1893T	possibly damaging	Het
Gabrr3	T	A	16: 59,448,009	D328E	probably damaging	Het
Gbp7	A	G	3: 142,544,030	I421V	possibly damaging	Het
Gorasp1	A	G	9: 119,928,356	S317P	probably damaging	Het
Htr6	A	G	4: 139,074,425	S113P	probably damaging	Het
Ift74	A	G	4: 94,632,714	E168G	probably damaging	Het
Kdm6b	A	T	11: 69,401,126	Y1443*	probably null	Het
Mmp28	A	C	11: 83,442,717	V466G	possibly damaging	Het
Nbea	A	T	3: 56,029,939	S750R	possibly damaging	Het
Nbeal1	T	C	1: 60,278,780	F1959L	probably damaging	Het
Nelfa	T	C	5: 33,900,509	N314D	probably benign	Het
Numbl	T	A	7: 27,268,921		probably null	Het
Olfr1370	G	T	13: 21,073,224	P26T	probably damaging	Het
Olfr1467	G	T	19: 13,365,074	V149F	probably benign	Het
Olfr272	T	A	4: 52,911,524	K90M	probably damaging	Het
Olfr346	G	A	2: 36,688,334	D111N	probably damaging	Het
Olfr678	T	C	7: 105,070,211	V248A	possibly damaging	Het
Penk	T	C	4: 4,134,041		probably null	Het
Pglyrp2	A	G	17: 32,418,962	S31P	probably damaging	Het
Pigg	T	C	5: 108,336,500	S538P	probably damaging	Het
Pld2	A	G	11: 70,542,989	T252A	possibly damaging	Het
Ppp2r5e	T	C	12: 75,462,324	I394V	probably benign	Het
Sh3rf1	G	T	8: 61,363,238	V510F	probably damaging	Het
Slc4a2	A	G	5: 24,435,653	H677R	possibly damaging	Het
Stam2	A	T	2: 52,703,144	H345Q	probably benign	Het
Tmtc3	T	C	10: 100,448,973	N600S	probably benign	Het
Trappc8	A	G	18: 20,819,222		probably null	Het
Vmn1r72	A	T	7: 11,669,668	C284*	probably null	Het
Vmn2r76	T	C	7: 86,225,535	I745V	probably benign	Het
Zfhx4	A	C	3: 5,403,332	D2850A	probably damaging	Het
Zfp764	A	G	7: 127,406,499	W36R	probably damaging	Het
Zfp804b	G	A	5: 6,771,674	T463I	probably damaging	Het
Zfp811	T	G	17: 32,797,721	K448N	probably damaging	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0975:Cyp2c67	UTSW	19	39609178	missense	possibly damaging	0.49
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1505:Cyp2c67	UTSW	19	39648964	missense	probably benign	0.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R3817:Cyp2c67	UTSW	19	39638683	missense	probably benign	0.00
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5345:Cyp2c67	UTSW	19	39626232	missense	probably benign	0.01
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6939:Cyp2c67	UTSW	19	39643334	missense	possibly damaging	0.68
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
R8717:Cyp2c67	UTSW	19	39638711	missense	probably benign	0.05
R8728:Cyp2c67	UTSW	19	39626161	missense	probably damaging	1.00
R9275:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9278:Cyp2c67	UTSW	19	39609255	missense	probably damaging	1.00
R9376:Cyp2c67	UTSW	19	39638734	missense	probably damaging	1.00
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AATAGAGAACTGTTAGCCTTGGG -3'
(R):5'- CTCAAACTCACTTATGTACGAGAC -3'

Sequencing Primer
(F):5'- CCTTGGGCAATTAGAGAACAGAAGC -3'
(R):5'- GTACGAGACATAGTTACCTTCTTTC -3'

Posted On

2014-10-02