Incidental Mutation 'R2182:D630045J12Rik'
ID237231
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 040184-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2182 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 38174147 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000117556] [ENSMUST00000169256] [ENSMUST00000169256]
Predicted Effect probably null
Transcript: ENSMUST00000117556
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117556
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably null
Transcript: ENSMUST00000169256
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169256
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,422,943 H17R probably damaging Het
Abca15 G A 7: 120,340,227 W281* probably null Het
Aloxe3 G A 11: 69,129,600 V157M possibly damaging Het
Arhgap26 G T 18: 39,357,809 probably benign Het
Atp7b T C 8: 22,014,547 N698S probably damaging Het
Casc4 A G 2: 121,867,428 D75G probably damaging Het
Clec4a4 A G 6: 123,013,757 probably null Het
Clgn C T 8: 83,410,410 T252I possibly damaging Het
Cyp2a12 A T 7: 27,031,146 N179Y probably damaging Het
Dennd5a G T 7: 109,933,994 R190S probably benign Het
Dtx4 C A 19: 12,483,107 G384V probably null Het
Dxo T C 17: 34,838,892 V191A probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fntb A G 12: 76,862,535 N99S probably benign Het
Gm5773 T A 3: 93,773,513 I164K probably benign Het
Hyal5 T C 6: 24,877,880 I325T probably damaging Het
Igsf8 G A 1: 172,290,728 probably null Het
Lamc2 A G 1: 153,126,866 V17A possibly damaging Het
Lpxn T C 19: 12,832,758 probably null Het
Macf1 A G 4: 123,492,671 V1296A probably damaging Het
Mpdz A T 4: 81,348,722 L318Q probably damaging Het
Mpl T A 4: 118,457,413 Q13L probably benign Het
Mpnd A G 17: 56,015,964 S399G probably benign Het
Mrps5 T C 2: 127,602,487 L347P probably damaging Het
Naip1 T A 13: 100,413,680 Q1217H probably benign Het
Nav2 G A 7: 49,597,254 V2176I probably benign Het
Olfr1341 T C 4: 118,710,345 *313R probably null Het
Olfr853 T C 9: 19,537,342 N196S probably benign Het
Olfr902 A G 9: 38,449,124 N84S probably benign Het
Olfr957 A T 9: 39,511,426 M98K probably damaging Het
Pbx2 C A 17: 34,595,666 Y324* probably null Het
Pcsk7 T A 9: 45,928,619 C702S probably benign Het
Pramef6 T A 4: 143,897,190 H138L possibly damaging Het
Rictor T C 15: 6,772,204 S458P probably damaging Het
Rnf219 A G 14: 104,506,176 S156P possibly damaging Het
Scaf4 T C 16: 90,230,140 M905V probably benign Het
Scarf2 T C 16: 17,803,022 C185R probably damaging Het
Scd1 T G 19: 44,403,293 I101L probably benign Het
Slc6a2 A G 8: 92,961,248 M1V probably null Het
Sost T C 11: 101,963,850 Y211C probably damaging Het
Sphkap A G 1: 83,276,684 S828P probably damaging Het
Tnn T C 1: 160,140,600 probably null Het
Tnrc18 T C 5: 142,760,061 K1319R unknown Het
Vmn2r60 A G 7: 42,195,507 T765A probably benign Het
Vmn2r91 C A 17: 18,105,429 T103K possibly damaging Het
Zbtb44 T C 9: 31,066,676 C429R possibly damaging Het
Zc3h4 G A 7: 16,422,516 G327D unknown Het
Zfp292 A G 4: 34,807,417 C1876R probably damaging Het
Zfp839 C T 12: 110,868,338 L676F probably damaging Het
Zg16 A G 7: 127,050,372 L139P probably damaging Het
Zscan12 A G 13: 21,368,791 I262V probably benign Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38174303 missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38142666 missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38148448 missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38196627 missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38195494 missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38149563 missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38177701 missense probably damaging 1.00
R7950:D630045J12Rik UTSW 6 38181310 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGACTCACTAGCAACTCC -3'
(R):5'- AAGGTGGTGAACGTGTCCAG -3'

Sequencing Primer
(F):5'- ATGCACCATGGCATGTGTAC -3'
(R):5'- TGAACGTGTCCAGGCTGG -3'
Posted On2014-10-02