Incidental Mutation 'R2182:Zc3h4'
ID237233
Institutional Source Beutler Lab
Gene Symbol Zc3h4
Ensembl Gene ENSMUSG00000059273
Gene Namezinc finger CCCH-type containing 4
SynonymsLOC330474, Kiaa1064-hp, Bwq1
MMRRC Submission 040184-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2182 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16400910-16437696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16422516 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 327 (G327D)
Ref Sequence ENSEMBL: ENSMUSP00000147665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098789] [ENSMUST00000209289]
Predicted Effect unknown
Transcript: ENSMUST00000098789
AA Change: G319D
SMART Domains Protein: ENSMUSP00000096386
Gene: ENSMUSG00000059273
AA Change: G319D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 35 97 N/A INTRINSIC
low complexity region 144 170 N/A INTRINSIC
low complexity region 184 247 N/A INTRINSIC
low complexity region 264 324 N/A INTRINSIC
ZnF_C3H1 341 366 1.95e-3 SMART
ZnF_C3H1 370 395 6.17e-6 SMART
ZnF_C3H1 396 419 3.38e-1 SMART
low complexity region 433 451 N/A INTRINSIC
low complexity region 456 486 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 552 641 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
coiled coil region 729 760 N/A INTRINSIC
internal_repeat_2 767 822 3.38e-5 PROSPERO
low complexity region 837 850 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
internal_repeat_2 986 1037 3.38e-5 PROSPERO
low complexity region 1049 1072 N/A INTRINSIC
low complexity region 1077 1097 N/A INTRINSIC
low complexity region 1175 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209289
AA Change: G327D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209374
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,422,943 H17R probably damaging Het
Abca15 G A 7: 120,340,227 W281* probably null Het
Aloxe3 G A 11: 69,129,600 V157M possibly damaging Het
Arhgap26 G T 18: 39,357,809 probably benign Het
Atp7b T C 8: 22,014,547 N698S probably damaging Het
Casc4 A G 2: 121,867,428 D75G probably damaging Het
Clec4a4 A G 6: 123,013,757 probably null Het
Clgn C T 8: 83,410,410 T252I possibly damaging Het
Cyp2a12 A T 7: 27,031,146 N179Y probably damaging Het
D630045J12Rik C T 6: 38,174,147 probably null Het
Dennd5a G T 7: 109,933,994 R190S probably benign Het
Dtx4 C A 19: 12,483,107 G384V probably null Het
Dxo T C 17: 34,838,892 V191A probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fntb A G 12: 76,862,535 N99S probably benign Het
Gm5773 T A 3: 93,773,513 I164K probably benign Het
Hyal5 T C 6: 24,877,880 I325T probably damaging Het
Igsf8 G A 1: 172,290,728 probably null Het
Lamc2 A G 1: 153,126,866 V17A possibly damaging Het
Lpxn T C 19: 12,832,758 probably null Het
Macf1 A G 4: 123,492,671 V1296A probably damaging Het
Mpdz A T 4: 81,348,722 L318Q probably damaging Het
Mpl T A 4: 118,457,413 Q13L probably benign Het
Mpnd A G 17: 56,015,964 S399G probably benign Het
Mrps5 T C 2: 127,602,487 L347P probably damaging Het
Naip1 T A 13: 100,413,680 Q1217H probably benign Het
Nav2 G A 7: 49,597,254 V2176I probably benign Het
Olfr1341 T C 4: 118,710,345 *313R probably null Het
Olfr853 T C 9: 19,537,342 N196S probably benign Het
Olfr902 A G 9: 38,449,124 N84S probably benign Het
Olfr957 A T 9: 39,511,426 M98K probably damaging Het
Pbx2 C A 17: 34,595,666 Y324* probably null Het
Pcsk7 T A 9: 45,928,619 C702S probably benign Het
Pramef6 T A 4: 143,897,190 H138L possibly damaging Het
Rictor T C 15: 6,772,204 S458P probably damaging Het
Rnf219 A G 14: 104,506,176 S156P possibly damaging Het
Scaf4 T C 16: 90,230,140 M905V probably benign Het
Scarf2 T C 16: 17,803,022 C185R probably damaging Het
Scd1 T G 19: 44,403,293 I101L probably benign Het
Slc6a2 A G 8: 92,961,248 M1V probably null Het
Sost T C 11: 101,963,850 Y211C probably damaging Het
Sphkap A G 1: 83,276,684 S828P probably damaging Het
Tnn T C 1: 160,140,600 probably null Het
Tnrc18 T C 5: 142,760,061 K1319R unknown Het
Vmn2r60 A G 7: 42,195,507 T765A probably benign Het
Vmn2r91 C A 17: 18,105,429 T103K possibly damaging Het
Zbtb44 T C 9: 31,066,676 C429R possibly damaging Het
Zfp292 A G 4: 34,807,417 C1876R probably damaging Het
Zfp839 C T 12: 110,868,338 L676F probably damaging Het
Zg16 A G 7: 127,050,372 L139P probably damaging Het
Zscan12 A G 13: 21,368,791 I262V probably benign Het
Other mutations in Zc3h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zc3h4 APN 7 16422234 missense unknown
IGL00923:Zc3h4 APN 7 16429692 missense unknown
IGL01541:Zc3h4 APN 7 16434332 missense unknown
IGL02115:Zc3h4 APN 7 16425783 missense unknown
IGL02303:Zc3h4 APN 7 16434077 missense unknown
IGL02336:Zc3h4 APN 7 16425777 missense unknown
IGL02734:Zc3h4 APN 7 16423924 missense unknown
IGL02736:Zc3h4 APN 7 16417383 nonsense probably null
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0220:Zc3h4 UTSW 7 16429273 missense unknown
R0336:Zc3h4 UTSW 7 16435178 missense unknown
R0416:Zc3h4 UTSW 7 16420275 missense probably damaging 1.00
R0666:Zc3h4 UTSW 7 16434772 missense unknown
R0864:Zc3h4 UTSW 7 16420179 missense probably damaging 0.99
R1068:Zc3h4 UTSW 7 16429236 missense unknown
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1472:Zc3h4 UTSW 7 16434770 missense unknown
R1665:Zc3h4 UTSW 7 16429580 missense unknown
R2087:Zc3h4 UTSW 7 16416940 missense possibly damaging 0.72
R2508:Zc3h4 UTSW 7 16434339 missense unknown
R3037:Zc3h4 UTSW 7 16421485 missense unknown
R4439:Zc3h4 UTSW 7 16429111 missense unknown
R4576:Zc3h4 UTSW 7 16434654 missense unknown
R5030:Zc3h4 UTSW 7 16422230 missense unknown
R5160:Zc3h4 UTSW 7 16434648 missense unknown
R5270:Zc3h4 UTSW 7 16434515 missense unknown
R5490:Zc3h4 UTSW 7 16429005 missense unknown
R5519:Zc3h4 UTSW 7 16435232 missense unknown
R5770:Zc3h4 UTSW 7 16429611 missense unknown
R7067:Zc3h4 UTSW 7 16429051 nonsense probably null
R7234:Zc3h4 UTSW 7 16429036 missense unknown
R7316:Zc3h4 UTSW 7 16435335 missense unknown
X0064:Zc3h4 UTSW 7 16422516 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAGTTAAATCCCTTCTCGGC -3'
(R):5'- AGGGCCTGGAGAGATTGATC -3'

Sequencing Primer
(F):5'- CTTCTCCACAGGGTTGAGTCGAG -3'
(R):5'- CTGAATTCAAGGCCAGCTTG -3'
Posted On2014-10-02