Incidental Mutation 'R0173:Tbpl1'
ID23724
Institutional Source Beutler Lab
Gene Symbol Tbpl1
Ensembl Gene ENSMUSG00000071359
Gene NameTATA box binding protein-like 1
SynonymsTRP, Tlp, TLF, TRF2
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R0173 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location22703879-22731938 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22707624 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 149 (L149*)
Ref Sequence ENSEMBL: ENSMUSP00000114223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261] [ENSMUST00000095794] [ENSMUST00000127698]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095794
AA Change: L149*
SMART Domains Protein: ENSMUSP00000093470
Gene: ENSMUSG00000071359
AA Change: L149*

DomainStartEndE-ValueType
Pfam:TBP 8 92 8.3e-24 PFAM
Pfam:TBP 97 182 4.5e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127698
AA Change: L149*
SMART Domains Protein: ENSMUSP00000114223
Gene: ENSMUSG00000071359
AA Change: L149*

DomainStartEndE-ValueType
Pfam:TBP 10 91 2.4e-25 PFAM
Pfam:TBP 99 181 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141569
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygous for targeted null mutations are sterile due to a block in spermiogenesis. Spermatids exhibit defective acrosome formation, fragmentation of the chromocenter, and develop at most to step 7 of differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Tbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Tbpl1 APN 10 22707669 missense probably damaging 1.00
R1777:Tbpl1 UTSW 10 22707843 missense probably damaging 1.00
R2018:Tbpl1 UTSW 10 22707677 missense probably damaging 0.99
R2019:Tbpl1 UTSW 10 22707677 missense probably damaging 0.99
R2365:Tbpl1 UTSW 10 22705886 missense possibly damaging 0.93
R3841:Tbpl1 UTSW 10 22711908 splice site probably benign
R6598:Tbpl1 UTSW 10 22707849 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAAAGTACAGTCGAGTGCCAG -3'
(R):5'- TGTGTAACATGCCCTTTGAGATCCG -3'

Sequencing Primer
(F):5'- CCAGGTGCTAACGGAGACTAC -3'
(R):5'- GAGATCCGTTTGCCAGAATTTAC -3'
Posted On2013-04-16