Incidental Mutation 'R2182:Olfr957'
ID237247
Institutional Source Beutler Lab
Gene Symbol Olfr957
Ensembl Gene ENSMUSG00000095322
Gene Nameolfactory receptor 957
SynonymsGA_x6K02T2PVTD-33208209-33207274, MOR171-12
MMRRC Submission 040184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R2182 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39510234-39515809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39511426 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 98 (M98K)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
Predicted Effect probably damaging
Transcript: ENSMUST00000051653
AA Change: M98K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: M98K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216177
AA Change: M98K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,422,943 H17R probably damaging Het
Abca15 G A 7: 120,340,227 W281* probably null Het
Aloxe3 G A 11: 69,129,600 V157M possibly damaging Het
Arhgap26 G T 18: 39,357,809 probably benign Het
Atp7b T C 8: 22,014,547 N698S probably damaging Het
Casc4 A G 2: 121,867,428 D75G probably damaging Het
Clec4a4 A G 6: 123,013,757 probably null Het
Clgn C T 8: 83,410,410 T252I possibly damaging Het
Cyp2a12 A T 7: 27,031,146 N179Y probably damaging Het
D630045J12Rik C T 6: 38,174,147 probably null Het
Dennd5a G T 7: 109,933,994 R190S probably benign Het
Dtx4 C A 19: 12,483,107 G384V probably null Het
Dxo T C 17: 34,838,892 V191A probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fntb A G 12: 76,862,535 N99S probably benign Het
Gm5773 T A 3: 93,773,513 I164K probably benign Het
Hyal5 T C 6: 24,877,880 I325T probably damaging Het
Igsf8 G A 1: 172,290,728 probably null Het
Lamc2 A G 1: 153,126,866 V17A possibly damaging Het
Lpxn T C 19: 12,832,758 probably null Het
Macf1 A G 4: 123,492,671 V1296A probably damaging Het
Mpdz A T 4: 81,348,722 L318Q probably damaging Het
Mpl T A 4: 118,457,413 Q13L probably benign Het
Mpnd A G 17: 56,015,964 S399G probably benign Het
Mrps5 T C 2: 127,602,487 L347P probably damaging Het
Naip1 T A 13: 100,413,680 Q1217H probably benign Het
Nav2 G A 7: 49,597,254 V2176I probably benign Het
Olfr1341 T C 4: 118,710,345 *313R probably null Het
Olfr853 T C 9: 19,537,342 N196S probably benign Het
Olfr902 A G 9: 38,449,124 N84S probably benign Het
Pbx2 C A 17: 34,595,666 Y324* probably null Het
Pcsk7 T A 9: 45,928,619 C702S probably benign Het
Pramef6 T A 4: 143,897,190 H138L possibly damaging Het
Rictor T C 15: 6,772,204 S458P probably damaging Het
Rnf219 A G 14: 104,506,176 S156P possibly damaging Het
Scaf4 T C 16: 90,230,140 M905V probably benign Het
Scarf2 T C 16: 17,803,022 C185R probably damaging Het
Scd1 T G 19: 44,403,293 I101L probably benign Het
Slc6a2 A G 8: 92,961,248 M1V probably null Het
Sost T C 11: 101,963,850 Y211C probably damaging Het
Sphkap A G 1: 83,276,684 S828P probably damaging Het
Tnn T C 1: 160,140,600 probably null Het
Tnrc18 T C 5: 142,760,061 K1319R unknown Het
Vmn2r60 A G 7: 42,195,507 T765A probably benign Het
Vmn2r91 C A 17: 18,105,429 T103K possibly damaging Het
Zbtb44 T C 9: 31,066,676 C429R possibly damaging Het
Zc3h4 G A 7: 16,422,516 G327D unknown Het
Zfp292 A G 4: 34,807,417 C1876R probably damaging Het
Zfp839 C T 12: 110,868,338 L676F probably damaging Het
Zg16 A G 7: 127,050,372 L139P probably damaging Het
Zscan12 A G 13: 21,368,791 I262V probably benign Het
Other mutations in Olfr957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr957 APN 9 39511046 missense possibly damaging 0.64
R0603:Olfr957 UTSW 9 39511514 missense possibly damaging 0.76
R1642:Olfr957 UTSW 9 39511354 missense possibly damaging 0.78
R2044:Olfr957 UTSW 9 39511378 missense probably damaging 0.99
R2290:Olfr957 UTSW 9 39511678 missense possibly damaging 0.87
R4246:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R4248:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R5273:Olfr957 UTSW 9 39511499 missense possibly damaging 0.95
R5495:Olfr957 UTSW 9 39511145 missense probably benign 0.39
R5718:Olfr957 UTSW 9 39511042 missense probably damaging 1.00
R5827:Olfr957 UTSW 9 39511058 missense probably damaging 1.00
R6261:Olfr957 UTSW 9 39510809 missense probably benign
R6917:Olfr957 UTSW 9 39511199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCACCAGCTTTGCAGAAAAG -3'
(R):5'- GAAACCTGGGCATGGTCATG -3'

Sequencing Primer
(F):5'- TAAGCAGGCAGACTGTTTCC -3'
(R):5'- ATGGTCATGCTCATCCTGTTC -3'
Posted On2014-10-02