Incidental Mutation 'R2183:Scai'
ID237273
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Namesuppressor of cancer cell invasion
SynonymsA930041I02Rik
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location39066214-39190734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39080126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 542 (T542I)
Ref Sequence ENSEMBL: ENSMUSP00000037194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204404] [ENSMUST00000204500]
Predicted Effect probably benign
Transcript: ENSMUST00000038874
AA Change: T542I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: T542I

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect probably benign
Transcript: ENSMUST00000204093
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Predicted Effect probably benign
Transcript: ENSMUST00000204500
SMART Domains Protein: ENSMUSP00000144844
Gene: ENSMUSG00000035236

DomainStartEndE-ValueType
Pfam:DUF3550 1 77 3.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 39108394 missense probably damaging 1.00
IGL01366:Scai APN 2 39106961 missense probably benign 0.36
IGL01739:Scai APN 2 39094791 splice site probably benign
IGL02251:Scai APN 2 39099417 missense probably benign 0.01
IGL02274:Scai APN 2 39102317 unclassified probably benign
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0685:Scai UTSW 2 39103737 missense probably damaging 0.96
R0904:Scai UTSW 2 39075152 missense possibly damaging 0.90
R1655:Scai UTSW 2 39080117 missense possibly damaging 0.79
R1820:Scai UTSW 2 39106978 missense possibly damaging 0.82
R1913:Scai UTSW 2 39080081 missense probably damaging 1.00
R2068:Scai UTSW 2 39123013 missense probably damaging 1.00
R3237:Scai UTSW 2 39150314 splice site probably benign
R3933:Scai UTSW 2 39075052 missense probably benign 0.44
R5460:Scai UTSW 2 39083573 missense probably damaging 1.00
R5460:Scai UTSW 2 39083574 missense probably damaging 1.00
R6089:Scai UTSW 2 39083554 nonsense probably null
R6377:Scai UTSW 2 39102328 missense probably benign 0.02
R6606:Scai UTSW 2 39075135 missense probably benign 0.00
R7034:Scai UTSW 2 39121135 missense probably damaging 1.00
R7037:Scai UTSW 2 39190621 missense probably benign 0.04
R7171:Scai UTSW 2 39106936 missense possibly damaging 0.48
R7451:Scai UTSW 2 39125136 missense probably damaging 1.00
R7737:Scai UTSW 2 39123022 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGCCACAGTATTGTTAATCG -3'
(R):5'- AGTGGCTTAAATGGTTTCCTGC -3'

Sequencing Primer
(F):5'- TGGTATTACAGGCATGCACC -3'
(R):5'- GGTTTCCTGCTATGTATTGTATAGG -3'
Posted On2014-10-02