Incidental Mutation 'R2183:Olfr1086'
ID237274
Institutional Source Beutler Lab
Gene Symbol Olfr1086
Ensembl Gene ENSMUSG00000075175
Gene Nameolfactory receptor 1086
SynonymsGA_x6K02T2Q125-48168771-48167839, MOR179-2
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86676218-86680092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86677036 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 99 (M99K)
Ref Sequence ENSEMBL: ENSMUSP00000150094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099878] [ENSMUST00000213198]
Predicted Effect probably benign
Transcript: ENSMUST00000099878
AA Change: M99K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097463
Gene: ENSMUSG00000075175
AA Change: M99K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-49 PFAM
Pfam:7tm_1 39 288 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213198
AA Change: M99K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Olfr1086
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1086 APN 2 86677081 missense probably benign 0.00
R0492:Olfr1086 UTSW 2 86676490 missense probably damaging 1.00
R0629:Olfr1086 UTSW 2 86676529 missense possibly damaging 0.65
R1114:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R1341:Olfr1086 UTSW 2 86677163 missense possibly damaging 0.86
R1868:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R3159:Olfr1086 UTSW 2 86676511 missense probably benign 0.03
R4061:Olfr1086 UTSW 2 86676818 missense probably damaging 1.00
R4420:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R5514:Olfr1086 UTSW 2 86676881 missense probably benign 0.03
R7066:Olfr1086 UTSW 2 86677226 missense possibly damaging 0.95
R7077:Olfr1086 UTSW 2 86676892 missense possibly damaging 0.78
R7246:Olfr1086 UTSW 2 86677289 missense probably benign 0.11
R7383:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R8062:Olfr1086 UTSW 2 86677066 missense probably benign 0.01
X0064:Olfr1086 UTSW 2 86677199 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTCTGAAAGTAGCCACCG -3'
(R):5'- CAATTTACCTCTTCACACTCATGGG -3'

Sequencing Primer
(F):5'- GTAGCCACCGTGTGAATAACAGC -3'
(R):5'- CACACTCATGGGAAATTTAGGACTG -3'
Posted On2014-10-02