Incidental Mutation 'R2183:Zfp971'
ID237276
Institutional Source Beutler Lab
Gene Symbol Zfp971
Ensembl Gene ENSMUSG00000074519
Gene Namezinc finger protein 971
SynonymsEtohi1
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2183 (G1)
Quality Score81
Status Not validated
Chromosome2
Chromosomal Location178023284-178034022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 178033740 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 377 (H377Q)
Ref Sequence ENSEMBL: ENSMUSP00000104554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108925] [ENSMUST00000108926]
Predicted Effect probably benign
Transcript: ENSMUST00000108925
SMART Domains Protein: ENSMUSP00000104553
Gene: ENSMUSG00000074519

DomainStartEndE-ValueType
KRAB 4 64 1.2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108926
AA Change: H377Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104554
Gene: ENSMUSG00000074519
AA Change: H377Q

DomainStartEndE-ValueType
KRAB 4 66 1.6e-13 SMART
ZnF_C2H2 78 97 1.38e2 SMART
ZnF_C2H2 103 125 4.38e1 SMART
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 4.79e-3 SMART
ZnF_C2H2 187 209 2.36e-2 SMART
ZnF_C2H2 215 237 2.36e-2 SMART
ZnF_C2H2 243 265 3.69e-4 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 4.4e-2 SMART
ZnF_C2H2 327 349 4.61e-5 SMART
ZnF_C2H2 355 377 4.94e-5 SMART
ZnF_C2H2 383 405 3.21e-4 SMART
ZnF_C2H2 411 433 4.47e-3 SMART
ZnF_C2H2 439 461 5.99e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Zfp971
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Zfp971 APN 2 178023382 critical splice donor site probably null
R1108:Zfp971 UTSW 2 178033670 missense probably damaging 1.00
R1759:Zfp971 UTSW 2 178033929 missense probably damaging 0.99
R2343:Zfp971 UTSW 2 178032994 missense possibly damaging 0.84
R4873:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R4875:Zfp971 UTSW 2 178033147 missense probably benign 0.24
R5263:Zfp971 UTSW 2 178033762 missense probably damaging 1.00
R5396:Zfp971 UTSW 2 178033733 missense probably damaging 1.00
R6150:Zfp971 UTSW 2 178033454 missense probably benign 0.26
R6693:Zfp971 UTSW 2 178033431 missense probably benign 0.01
R6811:Zfp971 UTSW 2 178033881 missense possibly damaging 0.62
R7427:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7428:Zfp971 UTSW 2 178033174 missense probably damaging 1.00
R7594:Zfp971 UTSW 2 178034000 missense possibly damaging 0.47
R7790:Zfp971 UTSW 2 178033499 missense probably damaging 0.96
R7796:Zfp971 UTSW 2 178031610 missense probably benign 0.00
R7934:Zfp971 UTSW 2 178033380 missense probably benign
R7990:Zfp971 UTSW 2 178033568 missense probably damaging 1.00
R8671:Zfp971 UTSW 2 178033937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTCATCTCCGAAGACA -3'
(R):5'- GTCACTCCTTACTGCAAAGGC -3'

Sequencing Primer
(F):5'- GCTGTCATCTCCGAAGACATAATCG -3'
(R):5'- CCTGCAAAGGGTTTACCATACTAG -3'
Posted On2014-10-02