Incidental Mutation 'R2183:Spg20'
ID237278
Institutional Source Beutler Lab
Gene Symbol Spg20
Ensembl Gene ENSMUSG00000036580
Gene Namespastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
SynonymsTAHCCP1
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location55112108-55137322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55117133 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 50 (I50V)
Ref Sequence ENSEMBL: ENSMUSP00000119719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118] [ENSMUST00000146109] [ENSMUST00000149767]
Predicted Effect probably benign
Transcript: ENSMUST00000044116
AA Change: I50V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107971
AA Change: I50V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117341
AA Change: I50V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118118
AA Change: I50V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146109
AA Change: I50V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121683
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149767
AA Change: I50V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119719
Gene: ENSMUSG00000036580
AA Change: I50V

DomainStartEndE-ValueType
MIT 16 92 6.83e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200658
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Spg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spg20 APN 3 55121756 missense probably damaging 1.00
IGL01539:Spg20 APN 3 55117302 missense possibly damaging 0.95
IGL01982:Spg20 APN 3 55128490 splice site probably null
IGL02345:Spg20 APN 3 55117726 splice site probably null
IGL03217:Spg20 APN 3 55128491 splice site probably benign
IGL03344:Spg20 APN 3 55121685 missense probably benign 0.03
BB007:Spg20 UTSW 3 55128276 missense probably damaging 1.00
BB017:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R0145:Spg20 UTSW 3 55127671 nonsense probably null
R0522:Spg20 UTSW 3 55128365 missense probably damaging 1.00
R1506:Spg20 UTSW 3 55117571 missense probably damaging 0.99
R2043:Spg20 UTSW 3 55127548 missense probably damaging 1.00
R4022:Spg20 UTSW 3 55117736 missense probably damaging 1.00
R5154:Spg20 UTSW 3 55117329 missense probably damaging 1.00
R5869:Spg20 UTSW 3 55135510 missense probably benign 0.00
R5987:Spg20 UTSW 3 55126541 missense probably benign 0.00
R6142:Spg20 UTSW 3 55117248 missense probably damaging 1.00
R6185:Spg20 UTSW 3 55117219 missense probably damaging 1.00
R6652:Spg20 UTSW 3 55124827 missense probably benign 0.00
R6791:Spg20 UTSW 3 55127561 missense probably damaging 1.00
R7131:Spg20 UTSW 3 55121799 critical splice donor site probably null
R7930:Spg20 UTSW 3 55128276 missense probably damaging 1.00
R8005:Spg20 UTSW 3 55117352 missense probably benign 0.00
R8458:Spg20 UTSW 3 55124894 missense probably damaging 1.00
R8734:Spg20 UTSW 3 55124879 missense possibly damaging 0.92
R8791:Spg20 UTSW 3 55121679 missense probably benign 0.19
R8929:Spg20 UTSW 3 55128558 missense possibly damaging 0.96
R9060:Spg20 UTSW 3 55124854 missense probably benign 0.02
RF009:Spg20 UTSW 3 55127606 missense probably benign 0.00
X0018:Spg20 UTSW 3 55135499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGAGCTAACTGGTTAATG -3'
(R):5'- GAACTCTGGGTATAGCTTGGGC -3'

Sequencing Primer
(F):5'- AGCTAACTGGTTAATGGCAGGTG -3'
(R):5'- ACATCCTGAAGGTCATTCCGTAGAG -3'
Posted On2014-10-02