Incidental Mutation 'R2183:Sgms2'
ID237279
Institutional Source Beutler Lab
Gene Symbol Sgms2
Ensembl Gene ENSMUSG00000050931
Gene Namesphingomyelin synthase 2
Synonyms4933405A16Rik, 5133401H06Rik
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location131318985-131491411 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 131336285 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090246]
Predicted Effect probably null
Transcript: ENSMUST00000090246
SMART Domains Protein: ENSMUSP00000087713
Gene: ENSMUSG00000050931

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:PAP2_C 220 293 5.5e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ceramide levels; decreased sphingomyelin, sphingomyelin-1-phosphate, and diacylglycerol levels; and resistance to lysenin-mediated cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Sgms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Sgms2 APN 3 131341833 missense possibly damaging 0.91
IGL01839:Sgms2 APN 3 131342102 missense possibly damaging 0.92
IGL02232:Sgms2 APN 3 131323184 missense probably benign
R0602:Sgms2 UTSW 3 131325107 critical splice acceptor site probably null
R4393:Sgms2 UTSW 3 131341817 splice site probably null
R4457:Sgms2 UTSW 3 131325016 missense probably damaging 1.00
R5050:Sgms2 UTSW 3 131330356 missense probably benign
R5052:Sgms2 UTSW 3 131330356 missense probably benign
R5088:Sgms2 UTSW 3 131330356 missense probably benign
R5224:Sgms2 UTSW 3 131342117 missense probably damaging 0.98
R5426:Sgms2 UTSW 3 131341797 missense probably benign 0.01
R5682:Sgms2 UTSW 3 131324962 missense probably damaging 0.99
R5735:Sgms2 UTSW 3 131336217 missense probably damaging 1.00
R6892:Sgms2 UTSW 3 131342154 missense probably benign
R7149:Sgms2 UTSW 3 131336259 missense possibly damaging 0.78
R7762:Sgms2 UTSW 3 131323249 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTGGGTGCTCTGGAATTGC -3'
(R):5'- AGGTAGCTCACAGGCCTTAAAATG -3'

Sequencing Primer
(F):5'- AATTGCTTTCCCAATTCCCCTCTG -3'
(R):5'- GATTAAAATATTGGATCCAGGCGTG -3'
Posted On2014-10-02