Incidental Mutation 'R2183:Rbsn'
ID237289
Institutional Source Beutler Lab
Gene Symbol Rbsn
Ensembl Gene ENSMUSG00000014550
Gene Namerabenosyn, RAB effector
Synonyms5330426D11Rik, Rabenosyn-5, Zfyve20
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92186712-92214925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92189637 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 675 (L675F)
Ref Sequence ENSEMBL: ENSMUSP00000014694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014694]
Predicted Effect probably benign
Transcript: ENSMUST00000014694
AA Change: L675F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000014694
Gene: ENSMUSG00000014550
AA Change: L675F

DomainStartEndE-ValueType
ZnF_C2H2 14 37 4.45e0 SMART
low complexity region 53 64 N/A INTRINSIC
FYVE 148 260 2e-10 SMART
coiled coil region 377 412 N/A INTRINSIC
Pfam:Rbsn 457 498 9e-21 PFAM
low complexity region 512 535 N/A INTRINSIC
Pfam:NPF 547 736 2.3e-61 PFAM
Pfam:Rbsn 737 778 6.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204858
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FYVE zinc finger family of proteins. The encoded protein interacts with Ras-related proteins that regulate membrane trafficking. A missense mutation in this gene is associated with a defect in the early endocytic pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Rbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Rbsn APN 6 92207119 missense possibly damaging 0.82
IGL02073:Rbsn APN 6 92189359 missense probably damaging 1.00
IGL02962:Rbsn APN 6 92190326 missense probably benign 0.00
R0172:Rbsn UTSW 6 92211607 missense probably damaging 0.99
R0735:Rbsn UTSW 6 92189693 missense probably benign 0.01
R0909:Rbsn UTSW 6 92189810 nonsense probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1728:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1729:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1784:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R2135:Rbsn UTSW 6 92189873 missense probably benign
R2324:Rbsn UTSW 6 92193966 missense probably damaging 1.00
R2890:Rbsn UTSW 6 92207123 missense possibly damaging 0.52
R3729:Rbsn UTSW 6 92191335 missense possibly damaging 0.81
R4007:Rbsn UTSW 6 92189819 missense probably benign 0.00
R4356:Rbsn UTSW 6 92207048 missense possibly damaging 0.47
R5027:Rbsn UTSW 6 92198250 missense probably damaging 1.00
R5364:Rbsn UTSW 6 92193977 missense probably damaging 0.96
R5787:Rbsn UTSW 6 92199816 missense possibly damaging 0.81
R7092:Rbsn UTSW 6 92189626 missense probably damaging 1.00
R7134:Rbsn UTSW 6 92201627 missense probably damaging 1.00
R7165:Rbsn UTSW 6 92191334 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGCATCAAAGATGTAAGCCTTG -3'
(R):5'- CAGCAAAGTGATAAGGCCTCAC -3'

Sequencing Primer
(F):5'- AGCAGCTCCTCCTCGATGTG -3'
(R):5'- CTCAACCCGTTTGATGAAGACG -3'
Posted On2014-10-02