Incidental Mutation 'R2183:Cc2d1a'
ID237296
Institutional Source Beutler Lab
Gene Symbol Cc2d1a
Ensembl Gene ENSMUSG00000036686
Gene Namecoiled-coil and C2 domain containing 1A
SynonymsFreud-1, Tape
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84132828-84147936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84140399 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 371 (H371Q)
Ref Sequence ENSEMBL: ENSMUSP00000046449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000040383] [ENSMUST00000117424] [ENSMUST00000117424]
Predicted Effect probably damaging
Transcript: ENSMUST00000040383
AA Change: H371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: H371Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000040383
AA Change: H371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: H371Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117424
AA Change: H326Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: H326Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117424
AA Change: H326Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: H326Q

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154029
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Cc2d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Cc2d1a APN 8 84140265 missense possibly damaging 0.87
IGL01126:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01129:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01133:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01135:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01953:Cc2d1a APN 8 84143978 missense probably benign 0.00
IGL02216:Cc2d1a APN 8 84139313 nonsense probably null
IGL03131:Cc2d1a APN 8 84143427 missense probably damaging 1.00
IGL03268:Cc2d1a APN 8 84133525 missense probably damaging 1.00
IGL03401:Cc2d1a APN 8 84134629 missense probably benign 0.00
R0313:Cc2d1a UTSW 8 84136969 missense probably benign 0.38
R0811:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0812:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0893:Cc2d1a UTSW 8 84140839 splice site probably benign
R1440:Cc2d1a UTSW 8 84133975 critical splice donor site probably null
R1625:Cc2d1a UTSW 8 84139372 missense probably damaging 1.00
R5155:Cc2d1a UTSW 8 84141126 missense probably benign 0.00
R5959:Cc2d1a UTSW 8 84133503 nonsense probably null
R6046:Cc2d1a UTSW 8 84136942 missense possibly damaging 0.81
R6386:Cc2d1a UTSW 8 84138537 missense probably damaging 0.96
R6956:Cc2d1a UTSW 8 84135899 missense probably damaging 1.00
R6992:Cc2d1a UTSW 8 84134913 missense probably damaging 1.00
R7156:Cc2d1a UTSW 8 84135760 missense possibly damaging 0.69
R7396:Cc2d1a UTSW 8 84143745 splice site probably null
R7456:Cc2d1a UTSW 8 84140239 critical splice donor site probably null
R7787:Cc2d1a UTSW 8 84133515 missense possibly damaging 0.94
R8507:Cc2d1a UTSW 8 84134976 missense probably benign 0.37
R8808:Cc2d1a UTSW 8 84134970 missense probably damaging 1.00
RF007:Cc2d1a UTSW 8 84134669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGAAACATACTTGTGGTG -3'
(R):5'- AGGTTCTTTGAAGTGGGCAGAC -3'

Sequencing Primer
(F):5'- AAACATACTTGTGGTGGGGCCTAC -3'
(R):5'- TTGAAGTGGGCAGACTGGGC -3'
Posted On2014-10-02