Incidental Mutation 'R2183:Tbx18'
ID 237298
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene Name T-box18
Synonyms 2810012F10Rik, 2810404D13Rik
MMRRC Submission 040185-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2183 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 87584853-87613313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87587789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 443 (T443S)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: T443S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: T443S

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,454,908 (GRCm39) T287A possibly damaging Het
Atg9b C T 5: 24,595,491 (GRCm39) A263T probably benign Het
Cc2d1a A T 8: 84,867,028 (GRCm39) H371Q probably damaging Het
Ccdc39 T C 3: 33,875,581 (GRCm39) N537S possibly damaging Het
Cdc6 A T 11: 98,799,524 (GRCm39) K17* probably null Het
Cemip2 G A 19: 21,801,157 (GRCm39) R758Q possibly damaging Het
Cenpk T C 13: 104,370,671 (GRCm39) M64T probably damaging Het
Dhx57 T A 17: 80,582,760 (GRCm39) T282S probably benign Het
Frem1 G A 4: 82,909,732 (GRCm39) T757I probably benign Het
Gcsh A T 8: 117,715,885 (GRCm39) V66E probably damaging Het
Gdpd1 T C 11: 86,926,102 (GRCm39) N281S probably damaging Het
Hs1bp3 T C 12: 8,371,610 (GRCm39) V97A possibly damaging Het
Ipo11 T C 13: 107,061,595 (GRCm39) T22A probably benign Het
Irag1 A T 7: 110,498,189 (GRCm39) L402Q probably damaging Het
Lama1 A G 17: 68,098,004 (GRCm39) N1795D probably damaging Het
Larp4 T C 15: 99,909,778 (GRCm39) V627A probably benign Het
Lrp8 T C 4: 107,660,462 (GRCm39) C41R probably damaging Het
Mroh2b T A 15: 4,947,707 (GRCm39) probably null Het
Nebl T C 2: 17,409,027 (GRCm39) D357G probably damaging Het
Nrg2 T C 18: 36,329,804 (GRCm39) K137R probably benign Het
Or14c43 T A 7: 86,115,594 (GRCm39) V325E probably benign Het
Or1j14 C T 2: 36,417,723 (GRCm39) Q100* probably null Het
Or5t7 A T 2: 86,507,380 (GRCm39) M99K probably benign Het
Phc1 C A 6: 122,300,284 (GRCm39) V487L probably damaging Het
Piezo2 A G 18: 63,239,345 (GRCm39) V745A probably damaging Het
Proca1 A T 11: 78,094,975 (GRCm39) H83L possibly damaging Het
Prpf4 G A 4: 62,330,046 (GRCm39) V107I probably damaging Het
Ptprz1 G A 6: 23,002,284 (GRCm39) R1458Q probably benign Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rbsn C A 6: 92,166,618 (GRCm39) L675F probably benign Het
Recql5 T C 11: 115,787,613 (GRCm39) S514G probably benign Het
Scai G A 2: 38,970,138 (GRCm39) T542I probably benign Het
Sftpa1 G T 14: 40,854,823 (GRCm39) D73Y probably damaging Het
Sgms2 A C 3: 131,129,934 (GRCm39) probably null Het
Spart A G 3: 55,024,554 (GRCm39) I50V probably benign Het
Spata7 A T 12: 98,603,871 (GRCm39) K47N probably damaging Het
Tmem130 T C 5: 144,692,242 (GRCm39) D54G possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,656,957 (GRCm39) probably benign Het
Trp53rkb G T 2: 166,635,877 (GRCm39) V73L possibly damaging Het
Wwc2 A T 8: 48,295,961 (GRCm39) L1103H unknown Het
Yes1 T A 5: 32,802,370 (GRCm39) V95E probably damaging Het
Zfp971 T A 2: 177,675,533 (GRCm39) H377Q probably damaging Het
Zzef1 C T 11: 72,777,544 (GRCm39) R1792* probably null Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87,587,676 (GRCm39) missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87,587,714 (GRCm39) missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87,606,384 (GRCm39) missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87,595,596 (GRCm39) missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87,606,461 (GRCm39) missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87,589,912 (GRCm39) missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87,609,459 (GRCm39) missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87,612,882 (GRCm39) missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87,587,633 (GRCm39) missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87,611,706 (GRCm39) missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87,597,569 (GRCm39) splice site probably benign
R0374:Tbx18 UTSW 9 87,606,408 (GRCm39) missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87,606,462 (GRCm39) missense probably benign 0.13
R2141:Tbx18 UTSW 9 87,597,706 (GRCm39) missense probably damaging 0.99
R2233:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87,611,689 (GRCm39) missense probably benign
R4214:Tbx18 UTSW 9 87,606,518 (GRCm39) missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87,612,822 (GRCm39) missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87,609,502 (GRCm39) missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87,597,740 (GRCm39) missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87,595,566 (GRCm39) missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87,597,588 (GRCm39) nonsense probably null
R6659:Tbx18 UTSW 9 87,589,864 (GRCm39) missense probably damaging 1.00
R7001:Tbx18 UTSW 9 87,609,457 (GRCm39) missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87,587,317 (GRCm39) missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87,589,883 (GRCm39) missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87,612,750 (GRCm39) missense probably benign
R8147:Tbx18 UTSW 9 87,606,411 (GRCm39) missense probably damaging 0.97
R8993:Tbx18 UTSW 9 87,612,770 (GRCm39) missense probably benign 0.00
R9263:Tbx18 UTSW 9 87,611,521 (GRCm39) missense probably damaging 0.97
R9291:Tbx18 UTSW 9 87,611,535 (GRCm39) missense probably damaging 1.00
R9396:Tbx18 UTSW 9 87,609,432 (GRCm39) missense probably damaging 1.00
R9420:Tbx18 UTSW 9 87,612,675 (GRCm39) missense probably benign
R9508:Tbx18 UTSW 9 87,587,926 (GRCm39) missense probably damaging 0.96
R9577:Tbx18 UTSW 9 87,611,512 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCGATGGCATGATGTACTGAAG -3'
(R):5'- AGTTCTTCAGCTCTGCTCCAAG -3'

Sequencing Primer
(F):5'- TACTGAAGTTGAGGGGACATTCC -3'
(R):5'- CAAGGCACTGGGAATGCTGTC -3'
Posted On 2014-10-02