Incidental Mutation 'R2183:Spata7'
ID237305
Institutional Source Beutler Lab
Gene Symbol Spata7
Ensembl Gene ENSMUSG00000021007
Gene Namespermatogenesis associated 7
SynonymsB230306G18Rik, HSD3
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98628157-98669815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98637612 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 47 (K47N)
Ref Sequence ENSEMBL: ENSMUSP00000098705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048402] [ENSMUST00000101144] [ENSMUST00000101146]
Predicted Effect probably damaging
Transcript: ENSMUST00000048402
AA Change: K79N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045827
Gene: ENSMUSG00000021007
AA Change: K79N

DomainStartEndE-ValueType
Pfam:HSD3 9 410 1e-190 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101144
AA Change: K79N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098704
Gene: ENSMUSG00000021007
AA Change: K79N

DomainStartEndE-ValueType
Pfam:HSD3 6 131 7.5e-73 PFAM
Pfam:HSD3 122 244 6e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101146
AA Change: K47N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098705
Gene: ENSMUSG00000021007
AA Change: K47N

DomainStartEndE-ValueType
Pfam:HSD3 6 33 1e-11 PFAM
Pfam:HSD3 31 379 2.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele display progressive retinal rod cell degeneration, a thin retinal outer nuclear layer and impaired scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nebl T C 2: 17,404,216 D357G probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Spata7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spata7 APN 12 98668840 missense probably damaging 1.00
IGL02283:Spata7 APN 12 98658258 missense probably damaging 0.96
IGL02379:Spata7 APN 12 98634260 missense probably damaging 1.00
R0200:Spata7 UTSW 12 98663169 missense probably benign 0.32
R0422:Spata7 UTSW 12 98658265 missense probably damaging 0.99
R0847:Spata7 UTSW 12 98648430 missense possibly damaging 0.82
R1228:Spata7 UTSW 12 98634269 missense probably damaging 1.00
R1497:Spata7 UTSW 12 98668861 missense probably damaging 1.00
R1693:Spata7 UTSW 12 98664257 missense possibly damaging 0.85
R2507:Spata7 UTSW 12 98658450 missense probably benign
R3176:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3177:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3276:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3277:Spata7 UTSW 12 98637598 missense possibly damaging 0.78
R3951:Spata7 UTSW 12 98669473 missense probably damaging 0.98
R4698:Spata7 UTSW 12 98664277 missense probably damaging 1.00
R4919:Spata7 UTSW 12 98648453 missense possibly damaging 0.65
R5088:Spata7 UTSW 12 98669502 missense probably benign 0.43
R5583:Spata7 UTSW 12 98669331 missense probably damaging 0.98
R6414:Spata7 UTSW 12 98663220 critical splice donor site probably null
R6451:Spata7 UTSW 12 98658337 missense probably benign 0.02
R7167:Spata7 UTSW 12 98664296 missense probably damaging 1.00
R7316:Spata7 UTSW 12 98658612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGGCCTGGCATCAGC -3'
(R):5'- TGGAAGACAACTGAAGCTGCTAA -3'

Sequencing Primer
(F):5'- ATGAGCTGTTAATCCCACCTAG -3'
(R):5'- TATGCTGGTCTCAGAGGAAACAC -3'
Posted On2014-10-02