Incidental Mutation 'R2184:Marchf1'
ID 237356
Institutional Source Beutler Lab
Gene Symbol Marchf1
Ensembl Gene ENSMUSG00000036469
Gene Name membrane associated ring-CH-type finger 1
Synonyms March1, 2900024D24Rik
MMRRC Submission 040186-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R2184 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 66070552-66924289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66840075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 286 (E286G)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
AlphaFold Q6NZQ8
Predicted Effect probably benign
Transcript: ENSMUST00000039540
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110256
AA Change: E286G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: E286G

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,019,389 (GRCm39) R184G probably damaging Het
2300002M23Rik C A 17: 35,879,115 (GRCm39) A151E probably benign Het
A930011G23Rik C T 5: 99,380,228 (GRCm39) R339Q possibly damaging Het
Abcd2 T C 15: 91,075,642 (GRCm39) Y57C probably benign Het
Adprhl1 A G 8: 13,292,559 (GRCm39) V244A probably benign Het
Agl T C 3: 116,574,426 (GRCm39) N753D probably benign Het
Amotl1 T A 9: 14,486,686 (GRCm39) M440L probably benign Het
Angpt2 A G 8: 18,742,132 (GRCm39) Y475H probably benign Het
Angpt4 A T 2: 151,780,874 (GRCm39) H374L probably damaging Het
Ank1 A T 8: 23,599,270 (GRCm39) T801S probably damaging Het
Ap5m1 G T 14: 49,323,752 (GRCm39) A481S probably damaging Het
AY358078 G T 14: 52,063,445 (GRCm39) G364W probably damaging Het
C4b C A 17: 34,956,676 (GRCm39) A641S probably benign Het
Capn13 T C 17: 73,672,943 (GRCm39) Y120C probably damaging Het
Cbx6 T C 15: 79,712,762 (GRCm39) T222A probably benign Het
Cckar T C 5: 53,860,254 (GRCm39) T192A probably damaging Het
Cdc42bpb T C 12: 111,262,478 (GRCm39) D30G probably damaging Het
Cdk18 A G 1: 132,043,690 (GRCm39) Y385H probably damaging Het
Cep170 A T 1: 176,584,542 (GRCm39) D612E probably benign Het
Dennd4b G T 3: 90,182,847 (GRCm39) R888L probably damaging Het
Egf A T 3: 129,517,007 (GRCm39) C373* probably null Het
Gabrb2 T C 11: 42,312,255 (GRCm39) probably null Het
Gle1 G T 2: 29,839,030 (GRCm39) A482S probably damaging Het
Gm10644 T C 8: 84,660,256 (GRCm39) T30A possibly damaging Het
Gmnn A G 13: 24,937,706 (GRCm39) Y95H probably damaging Het
Hectd3 T A 4: 116,858,100 (GRCm39) S643T possibly damaging Het
Hoga1 A G 19: 42,049,830 (GRCm39) Y225C probably damaging Het
Hook3 T C 8: 26,609,011 (GRCm39) E11G probably benign Het
Hsd17b1 C A 11: 100,969,357 (GRCm39) S30R probably benign Het
Htr3b G A 9: 48,858,544 (GRCm39) P112S probably damaging Het
Iqch T A 9: 63,432,351 (GRCm39) D348V probably damaging Het
Irgm2 A T 11: 58,111,254 (GRCm39) N327I probably benign Het
Itgb4 T C 11: 115,870,450 (GRCm39) I93T probably damaging Het
Lamb2 T C 9: 108,357,752 (GRCm39) F92L probably damaging Het
Lats2 T C 14: 57,929,016 (GRCm39) H953R probably damaging Het
Lrp1b T C 2: 40,620,714 (GRCm39) E3588G probably benign Het
Mc2r G T 18: 68,541,196 (GRCm39) F32L probably benign Het
Mink1 C T 11: 70,494,623 (GRCm39) T268M probably damaging Het
Mta1 G A 12: 113,093,815 (GRCm39) probably null Het
Muc5b C A 7: 141,412,601 (GRCm39) S1849* probably null Het
Myh15 A G 16: 48,957,874 (GRCm39) E897G probably damaging Het
Nobox T C 6: 43,281,819 (GRCm39) Q418R possibly damaging Het
Obsl1 G T 1: 75,478,861 (GRCm39) Q626K probably benign Het
Or11h4 A G 14: 50,974,059 (GRCm39) S187P probably damaging Het
Or13a24 T C 7: 140,154,315 (GRCm39) V83A probably benign Het
Or1j12 A G 2: 36,343,046 (GRCm39) T150A probably benign Het
Or2w25 T A 11: 59,503,964 (GRCm39) M58K probably damaging Het
Or5w14 G A 2: 87,541,549 (GRCm39) R234C probably damaging Het
Or8k24 G A 2: 86,216,489 (GRCm39) T91I probably benign Het
Or9i1 A G 19: 13,839,399 (GRCm39) I81V probably benign Het
Pald1 C T 10: 61,182,915 (GRCm39) A345T possibly damaging Het
Pde8b G A 13: 95,162,723 (GRCm39) P800S probably damaging Het
Pgm2l1 G A 7: 99,917,362 (GRCm39) C493Y possibly damaging Het
Pias3 A G 3: 96,609,537 (GRCm39) S311G possibly damaging Het
Pkhd1l1 A G 15: 44,362,692 (GRCm39) N573D possibly damaging Het
Plaat3 A G 19: 7,556,583 (GRCm39) D128G probably damaging Het
Plxnc1 T G 10: 94,780,131 (GRCm39) S104R probably damaging Het
Pofut2 T A 10: 77,103,059 (GRCm39) F179I probably damaging Het
Prkcsh T A 9: 21,916,028 (GRCm39) C112S probably damaging Het
Prss32 G A 17: 24,078,297 (GRCm39) A328T probably benign Het
Ptgir G T 7: 16,642,708 (GRCm39) R103L probably damaging Het
Ptpn5 G A 7: 46,738,350 (GRCm39) S244F probably damaging Het
Rnpepl1 G A 1: 92,844,545 (GRCm39) V346I probably benign Het
Sh3rf1 T A 8: 61,825,688 (GRCm39) V561D probably damaging Het
Slc22a19 A T 19: 7,687,026 (GRCm39) Y160N probably benign Het
Sorbs3 A G 14: 70,428,880 (GRCm39) probably null Het
Sostdc1 T G 12: 36,367,295 (GRCm39) I157S probably damaging Het
Svil G T 18: 5,099,534 (GRCm39) R1777L probably damaging Het
Svil A T 18: 5,099,615 (GRCm39) E1804V probably damaging Het
Tasor T A 14: 27,188,141 (GRCm39) N862K possibly damaging Het
Thbs4 A G 13: 92,911,302 (GRCm39) S294P probably benign Het
Tle2 A G 10: 81,426,111 (GRCm39) Y750C probably damaging Het
Tmcc3 T C 10: 94,418,168 (GRCm39) L312P probably damaging Het
Tnip2 TCTCCT TCT 5: 34,656,957 (GRCm39) probably benign Het
Tnpo2 T A 8: 85,780,475 (GRCm39) M734K probably benign Het
Trmt2a A T 16: 18,070,859 (GRCm39) R531W probably benign Het
Ubn2 C T 6: 38,461,029 (GRCm39) R483W probably damaging Het
Zc3hav1 T A 6: 38,284,343 (GRCm39) Y924F probably damaging Het
Other mutations in Marchf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Marchf1 APN 8 66,871,529 (GRCm39) missense possibly damaging 0.88
IGL02468:Marchf1 APN 8 66,871,563 (GRCm39) missense probably damaging 1.00
R0391:Marchf1 UTSW 8 66,871,625 (GRCm39) missense probably damaging 1.00
R1500:Marchf1 UTSW 8 66,921,042 (GRCm39) missense probably damaging 1.00
R1794:Marchf1 UTSW 8 66,839,594 (GRCm39) missense possibly damaging 0.63
R2015:Marchf1 UTSW 8 66,574,473 (GRCm39) missense probably damaging 0.99
R2273:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2274:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2275:Marchf1 UTSW 8 66,840,151 (GRCm39) missense probably benign 0.15
R2314:Marchf1 UTSW 8 66,574,442 (GRCm39) start codon destroyed probably null 0.77
R3114:Marchf1 UTSW 8 66,840,033 (GRCm39) missense probably benign
R4458:Marchf1 UTSW 8 66,908,823 (GRCm39) missense probably damaging 1.00
R4656:Marchf1 UTSW 8 66,839,071 (GRCm39) missense probably benign 0.05
R4773:Marchf1 UTSW 8 66,839,876 (GRCm39) missense probably benign 0.03
R4838:Marchf1 UTSW 8 66,921,015 (GRCm39) missense probably damaging 1.00
R5073:Marchf1 UTSW 8 66,839,020 (GRCm39) missense probably benign 0.03
R5507:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R5575:Marchf1 UTSW 8 66,920,962 (GRCm39) missense probably damaging 1.00
R5916:Marchf1 UTSW 8 66,839,763 (GRCm39) missense possibly damaging 0.89
R6931:Marchf1 UTSW 8 66,921,144 (GRCm39) missense probably benign 0.03
R7350:Marchf1 UTSW 8 66,921,051 (GRCm39) nonsense probably null
R7487:Marchf1 UTSW 8 66,908,726 (GRCm39) missense probably benign 0.14
R7531:Marchf1 UTSW 8 66,838,989 (GRCm39) missense probably benign
R7563:Marchf1 UTSW 8 66,920,965 (GRCm39) missense probably damaging 1.00
R7705:Marchf1 UTSW 8 66,921,169 (GRCm39) missense probably benign 0.00
R8142:Marchf1 UTSW 8 66,908,778 (GRCm39) missense probably benign 0.07
R8337:Marchf1 UTSW 8 66,871,641 (GRCm39) missense probably damaging 1.00
R8712:Marchf1 UTSW 8 66,921,000 (GRCm39) missense probably damaging 1.00
R9188:Marchf1 UTSW 8 66,908,803 (GRCm39) nonsense probably null
R9372:Marchf1 UTSW 8 66,921,145 (GRCm39) missense probably benign 0.01
R9477:Marchf1 UTSW 8 66,871,542 (GRCm39) missense probably damaging 1.00
R9790:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
R9791:Marchf1 UTSW 8 66,729,339 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGACAGAATGTGGGAGTCAC -3'
(R):5'- TGAGCTCCCATCCAGAAGAC -3'

Sequencing Primer
(F):5'- GTGGGAGTCACACTTTAAACATCTG -3'
(R):5'- CCAGAAGACTTATAATTGGGTTGCG -3'
Posted On 2014-10-02