Mutagenetix > Incidental Mutation

Incidental Mutation 'R2184:Thbs4'

237381

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

040186-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2184 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92774794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 294 (S294P)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: S294P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: S294P

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168299

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700088E04Rik	T	C	15: 79,135,189	R184G	probably damaging	Het
2300002M23Rik	C	A	17: 35,568,218	A151E	probably benign	Het
A930011G23Rik	C	T	5: 99,232,369	R339Q	possibly damaging	Het
Abcd2	T	C	15: 91,191,439	Y57C	probably benign	Het
Adprhl1	A	G	8: 13,242,559	V244A	probably benign	Het
Agl	T	C	3: 116,780,777	N753D	probably benign	Het
Amotl1	T	A	9: 14,575,390	M440L	probably benign	Het
Angpt2	A	G	8: 18,692,116	Y475H	probably benign	Het
Angpt4	A	T	2: 151,938,954	H374L	probably damaging	Het
Ank1	A	T	8: 23,109,254	T801S	probably damaging	Het
Ap5m1	G	T	14: 49,086,295	A481S	probably damaging	Het
AY358078	G	T	14: 51,825,988	G364W	probably damaging	Het
C4b	C	A	17: 34,737,702	A641S	probably benign	Het
Capn13	T	C	17: 73,365,948	Y120C	probably damaging	Het
Cbx6	T	C	15: 79,828,561	T222A	probably benign	Het
Cckar	T	C	5: 53,702,912	T192A	probably damaging	Het
Cdc42bpb	T	C	12: 111,296,044	D30G	probably damaging	Het
Cdk18	A	G	1: 132,115,952	Y385H	probably damaging	Het
Cep170	A	T	1: 176,756,976	D612E	probably benign	Het
Dennd4b	G	T	3: 90,275,540	R888L	probably damaging	Het
Egf	A	T	3: 129,723,358	C373*	probably null	Het
Fam208a	T	A	14: 27,466,184	N862K	possibly damaging	Het
Gabrb2	T	C	11: 42,421,428		probably null	Het
Gle1	G	T	2: 29,949,018	A482S	probably damaging	Het
Gm10644	T	C	8: 83,933,627	T30A	possibly damaging	Het
Gmnn	A	G	13: 24,753,723	Y95H	probably damaging	Het
Hectd3	T	A	4: 117,000,903	S643T	possibly damaging	Het
Hoga1	A	G	19: 42,061,391	Y225C	probably damaging	Het
Hook3	T	C	8: 26,118,983	E11G	probably benign	Het
Hsd17b1	C	A	11: 101,078,531	S30R	probably benign	Het
Htr3b	G	A	9: 48,947,244	P112S	probably damaging	Het
Iqch	T	A	9: 63,525,069	D348V	probably damaging	Het
Irgm2	A	T	11: 58,220,428	N327I	probably benign	Het
Itgb4	T	C	11: 115,979,624	I93T	probably damaging	Het
Lamb2	T	C	9: 108,480,553	F92L	probably damaging	Het
Lats2	T	C	14: 57,691,559	H953R	probably damaging	Het
Lrp1b	T	C	2: 40,730,702	E3588G	probably benign	Het
March1	A	G	8: 66,387,423	E286G	probably benign	Het
Mc2r	G	T	18: 68,408,125	F32L	probably benign	Het
Mink1	C	T	11: 70,603,797	T268M	probably damaging	Het
Mta1	G	A	12: 113,130,195		probably null	Het
Muc5b	C	A	7: 141,858,864	S1849*	probably null	Het
Myh15	A	G	16: 49,137,511	E897G	probably damaging	Het
Nobox	T	C	6: 43,304,885	Q418R	possibly damaging	Het
Obsl1	G	T	1: 75,502,217	Q626K	probably benign	Het
Olfr1058	G	A	2: 86,386,145	T91I	probably benign	Het
Olfr1137	G	A	2: 87,711,205	R234C	probably damaging	Het
Olfr1502	A	G	19: 13,862,035	I81V	probably benign	Het
Olfr225	T	A	11: 59,613,138	M58K	probably damaging	Het
Olfr340	A	G	2: 36,453,034	T150A	probably benign	Het
Olfr538	T	C	7: 140,574,402	V83A	probably benign	Het
Olfr749	A	G	14: 50,736,602	S187P	probably damaging	Het
Pald1	C	T	10: 61,347,136	A345T	possibly damaging	Het
Pde8b	G	A	13: 95,026,215	P800S	probably damaging	Het
Pgm2l1	G	A	7: 100,268,155	C493Y	possibly damaging	Het
Pias3	A	G	3: 96,702,221	S311G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,499,296	N573D	possibly damaging	Het
Pla2g16	A	G	19: 7,579,218	D128G	probably damaging	Het
Plxnc1	T	G	10: 94,944,269	S104R	probably damaging	Het
Pofut2	T	A	10: 77,267,225	F179I	probably damaging	Het
Prkcsh	T	A	9: 22,004,732	C112S	probably damaging	Het
Prss32	G	A	17: 23,859,323	A328T	probably benign	Het
Ptgir	G	T	7: 16,908,783	R103L	probably damaging	Het
Ptpn5	G	A	7: 47,088,602	S244F	probably damaging	Het
Rnpepl1	G	A	1: 92,916,823	V346I	probably benign	Het
Sh3rf1	T	A	8: 61,372,654	V561D	probably damaging	Het
Slc22a19	A	T	19: 7,709,661	Y160N	probably benign	Het
Sorbs3	A	G	14: 70,191,431		probably null	Het
Sostdc1	T	G	12: 36,317,296	I157S	probably damaging	Het
Svil	G	T	18: 5,099,534	R1777L	probably damaging	Het
Svil	A	T	18: 5,099,615	E1804V	probably damaging	Het
Tle2	A	G	10: 81,590,277	Y750C	probably damaging	Het
Tmcc3	T	C	10: 94,582,306	L312P	probably damaging	Het
Tnip2	TCTCCT	TCT	5: 34,499,613		probably benign	Het
Tnpo2	T	A	8: 85,053,846	M734K	probably benign	Het
Trmt2a	A	T	16: 18,252,995	R531W	probably benign	Het
Ubn2	C	T	6: 38,484,094	R483W	probably damaging	Het
Zc3hav1	T	A	6: 38,307,408	Y924F	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACACACAGTAGGGCTTCTTG -3'
(R):5'- TCTGCACAAGAGTTGATGGG -3'

Sequencing Primer
(F):5'- CTTCTTGGTCCACAGTGGCAAG -3'
(R):5'- TTGATGGGAAGGGGCAAATTCATTG -3'

Posted On

2014-10-02