Incidental Mutation 'R2170:AI481877'
ID237416
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Nameexpressed sequence AI481877
SynonymsLOC242489, Gm426
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2170 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59043753-59138983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59069215 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 737 (L737S)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107547
AA Change: L737S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: L737S

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,157 S404P probably damaging Het
4933434E20Rik T A 3: 90,056,304 L89Q probably benign Het
9330182L06Rik A G 5: 9,479,206 D221G probably damaging Het
Atxn2l T A 7: 126,503,239 probably benign Het
Bcl6 A G 16: 23,974,930 F89S probably damaging Het
Ccr1l1 C A 9: 123,978,135 V92F possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Chrne T C 11: 70,618,497 N86S probably damaging Het
Copg2 CCTCATC CC 6: 30,812,822 probably null Het
Eps8l2 T C 7: 141,342,071 S21P probably benign Het
Glb1 CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 9: 114,473,805 probably benign Het
Gm8251 A T 1: 44,056,008 S1977T probably benign Het
Gngt2 A G 11: 95,837,245 probably benign Het
Hecw2 T A 1: 53,942,797 E135V probably damaging Het
Hmcn2 G A 2: 31,380,281 A1177T probably benign Het
Itga10 T C 3: 96,650,457 V272A probably damaging Het
Kif17 A G 4: 138,288,371 I418M probably benign Het
Knl1 T C 2: 119,087,594 probably null Het
Lamc1 C T 1: 153,249,142 A628T probably benign Het
Mag A T 7: 30,908,987 L234* probably null Het
Muc5ac T A 7: 141,812,347 V2080E possibly damaging Het
Myo18b T C 5: 112,723,858 D2119G probably benign Het
Ncam1 C T 9: 49,798,681 A17T probably benign Het
Nipbl A G 15: 8,293,218 Y2570H probably damaging Het
Oasl2 T C 5: 114,906,800 V129A probably damaging Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr298 T A 7: 86,488,570 H327L probably benign Het
Podn A T 4: 108,022,533 L85Q probably damaging Het
Ppp1r12c A T 7: 4,482,806 D680E possibly damaging Het
Prdm14 G A 1: 13,122,460 L352F probably damaging Het
Prob1 G T 18: 35,654,737 Q155K probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Stard5 A G 7: 83,633,158 T60A probably benign Het
Syt7 A G 19: 10,439,380 K402E probably damaging Het
Tll2 T A 19: 41,183,275 D69V probably damaging Het
Vmn1r40 T C 6: 89,714,975 F258S probably benign Het
Zfp759 T A 13: 67,136,748 Y19N possibly damaging Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2873:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4006:AI481877 UTSW 4 59076500 missense possibly damaging 0.53
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4387:AI481877 UTSW 4 59060915 missense possibly damaging 0.66
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R4899:AI481877 UTSW 4 59062640 missense probably damaging 0.97
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R5929:AI481877 UTSW 4 59092497 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
R7355:AI481877 UTSW 4 59076155 missense probably benign
R7423:AI481877 UTSW 4 59076264 missense probably benign 0.27
R7484:AI481877 UTSW 4 59062286 missense probably damaging 0.97
R7560:AI481877 UTSW 4 59076140 missense possibly damaging 0.66
R7999:AI481877 UTSW 4 59094162 missense probably benign 0.27
R8198:AI481877 UTSW 4 59065174 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGAGGTCTTGAATTTGATCCCTAG -3'
(R):5'- GCTGTCACTGTTAATCAGATCTG -3'

Sequencing Primer
(F):5'- CTTGAATTTGATCCCTAGTGCTG -3'
(R):5'- AGGCATGCTGCTCTCTT -3'
Posted On2014-10-02