Incidental Mutation 'R0178:Cdh20'
ID 23742
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Name cadherin 20
Synonyms Cdh7
MMRRC Submission 038446-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R0178 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 104696254-104923206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104902776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 489 (D489V)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
AlphaFold Q9Z0M3
Predicted Effect possibly damaging
Transcript: ENSMUST00000062528
AA Change: D489V

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: D489V

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.9383 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,533,435 (GRCm39) N111T probably benign Het
Abca1 T C 4: 53,081,953 (GRCm39) D769G possibly damaging Het
Adcy6 G T 15: 98,502,096 (GRCm39) Q173K probably benign Het
Amotl1 G A 9: 14,460,069 (GRCm39) A890V probably benign Het
Arfgap2 C T 2: 91,097,706 (GRCm39) A141V probably benign Het
Asb2 G A 12: 103,291,811 (GRCm39) P324L probably damaging Het
Brd10 A G 19: 29,732,188 (GRCm39) S342P probably damaging Het
Cacna1g G A 11: 94,354,309 (GRCm39) T202I probably damaging Het
Capn5 A G 7: 97,782,098 (GRCm39) L214P probably damaging Het
Cers5 C A 15: 99,644,905 (GRCm39) probably benign Het
Chct1 A G 11: 85,069,264 (GRCm39) H94R probably benign Het
Chrnb3 T A 8: 27,883,392 (GRCm39) V111D probably damaging Het
Clec2m T C 6: 129,303,786 (GRCm39) R60G probably benign Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cyp2r1 T C 7: 114,149,643 (GRCm39) E248G probably damaging Het
Dnaaf11 A C 15: 66,325,950 (GRCm39) D208E probably benign Het
Dnmt3b A G 2: 153,516,938 (GRCm39) T536A probably benign Het
Eef2 G A 10: 81,016,126 (GRCm39) V496M possibly damaging Het
Fam118a T C 15: 84,930,081 (GRCm39) probably benign Het
Fer1l6 T A 15: 58,509,763 (GRCm39) probably null Het
Fhad1 A C 4: 141,682,651 (GRCm39) F497V probably benign Het
Gbe1 G A 16: 70,275,274 (GRCm39) G358D probably damaging Het
Gdf10 A G 14: 33,646,058 (GRCm39) D69G probably damaging Het
Ggt6 A G 11: 72,327,644 (GRCm39) H150R possibly damaging Het
Gm45713 A T 7: 44,783,882 (GRCm39) L110Q probably damaging Het
Gm9847 T C 12: 14,544,649 (GRCm39) noncoding transcript Het
Grwd1 T C 7: 45,480,054 (GRCm39) E51G probably damaging Het
Gvin3 A T 7: 106,201,028 (GRCm39) Y739N probably damaging Het
H13 A G 2: 152,522,987 (GRCm39) Y100C probably damaging Het
Kcne1 A C 16: 92,145,697 (GRCm39) M49R probably damaging Het
Kcnma1 C T 14: 23,576,835 (GRCm39) R236H probably damaging Het
Knl1 T A 2: 118,888,886 (GRCm39) probably benign Het
Krt40 T C 11: 99,432,565 (GRCm39) I150M probably damaging Het
Ldb2 A T 5: 44,630,841 (GRCm39) V300E probably damaging Het
Lrp1b A T 2: 40,615,919 (GRCm39) C3606S probably damaging Het
Lrrc42 A G 4: 107,104,917 (GRCm39) I16T probably damaging Het
Mtus1 G T 8: 41,455,398 (GRCm39) L87I possibly damaging Het
Myot T C 18: 44,470,053 (GRCm39) F10S probably damaging Het
Nrg3 A T 14: 38,098,413 (GRCm39) H480Q probably damaging Het
Or52b2 G A 7: 104,986,129 (GRCm39) R265C probably benign Het
Or5ac23 A T 16: 59,149,783 (GRCm39) F30I probably damaging Het
Prl2c5 A T 13: 13,366,390 (GRCm39) D220V probably damaging Het
Rbm17 G A 2: 11,592,590 (GRCm39) S295L probably benign Het
Serpina6 A G 12: 103,613,172 (GRCm39) I376T probably damaging Het
Sh2d2a A T 3: 87,756,730 (GRCm39) T192S probably benign Het
Slc27a1 T C 8: 72,037,106 (GRCm39) Y417H possibly damaging Het
Slc6a1 T G 6: 114,281,813 (GRCm39) I32S possibly damaging Het
Sntb1 T C 15: 55,769,540 (GRCm39) T150A probably damaging Het
Tanc1 T A 2: 59,665,791 (GRCm39) C1183* probably null Het
Tmprss7 C A 16: 45,511,206 (GRCm39) W57C probably damaging Het
Ubac1 A T 2: 25,911,440 (GRCm39) V36E possibly damaging Het
Zfc3h1 T C 10: 115,242,630 (GRCm39) probably benign Het
Zfp644 C T 5: 106,784,771 (GRCm39) C592Y probably damaging Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104,881,612 (GRCm39) missense probably benign 0.05
IGL00742:Cdh20 APN 1 109,993,356 (GRCm39) missense probably benign 0.22
IGL00743:Cdh20 APN 1 104,875,153 (GRCm39) missense probably benign 0.06
IGL00848:Cdh20 APN 1 104,861,981 (GRCm39) missense probably benign
IGL00861:Cdh20 APN 1 109,988,718 (GRCm39) splice site probably benign
IGL01016:Cdh20 APN 1 110,036,686 (GRCm39) critical splice donor site probably null
IGL01393:Cdh20 APN 1 104,861,969 (GRCm39) missense probably benign
IGL01396:Cdh20 APN 1 104,875,154 (GRCm39) missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104,861,832 (GRCm39) missense probably benign 0.05
IGL01538:Cdh20 APN 1 109,988,870 (GRCm39) missense probably damaging 1.00
IGL01612:Cdh20 APN 1 104,921,895 (GRCm39) missense probably benign 0.02
IGL01763:Cdh20 APN 1 109,993,520 (GRCm39) missense probably benign 0.00
IGL01765:Cdh20 APN 1 109,988,836 (GRCm39) missense probably damaging 1.00
IGL01937:Cdh20 APN 1 110,065,826 (GRCm39) missense probably benign
IGL01947:Cdh20 APN 1 104,921,649 (GRCm39) missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104,868,762 (GRCm39) missense probably damaging 1.00
IGL02020:Cdh20 APN 1 110,066,078 (GRCm39) missense probably damaging 1.00
IGL02135:Cdh20 APN 1 110,066,004 (GRCm39) nonsense probably null
IGL02226:Cdh20 APN 1 104,881,816 (GRCm39) splice site probably benign
IGL02285:Cdh20 APN 1 110,065,921 (GRCm39) missense probably damaging 1.00
IGL02318:Cdh20 APN 1 104,881,764 (GRCm39) missense probably null 0.03
IGL02326:Cdh20 APN 1 104,902,764 (GRCm39) missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104,875,190 (GRCm39) missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104,861,823 (GRCm39) start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104,868,982 (GRCm39) missense probably damaging 1.00
IGL03237:Cdh20 APN 1 110,066,037 (GRCm39) missense possibly damaging 0.89
IGL03280:Cdh20 APN 1 110,036,498 (GRCm39) nonsense probably null
IGL03347:Cdh20 APN 1 110,065,973 (GRCm39) missense possibly damaging 0.53
IGL03385:Cdh20 APN 1 109,993,516 (GRCm39) missense possibly damaging 0.90
3-1:Cdh20 UTSW 1 104,875,145 (GRCm39) missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
IGL02802:Cdh20 UTSW 1 110,065,655 (GRCm39) missense probably damaging 1.00
IGL02991:Cdh20 UTSW 1 104,861,972 (GRCm39) missense probably benign
R0030:Cdh20 UTSW 1 110,065,798 (GRCm39) nonsense probably null
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0255:Cdh20 UTSW 1 109,922,036 (GRCm39) missense probably benign 0.09
R0365:Cdh20 UTSW 1 110,036,486 (GRCm39) missense probably damaging 1.00
R0506:Cdh20 UTSW 1 110,027,844 (GRCm39) missense probably damaging 1.00
R0549:Cdh20 UTSW 1 110,036,674 (GRCm39) missense probably damaging 1.00
R0599:Cdh20 UTSW 1 109,980,696 (GRCm39) missense probably damaging 1.00
R0648:Cdh20 UTSW 1 109,993,337 (GRCm39) splice site probably benign
R1033:Cdh20 UTSW 1 110,012,783 (GRCm39) missense probably damaging 0.96
R1114:Cdh20 UTSW 1 104,906,739 (GRCm39) missense probably damaging 0.96
R1173:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1174:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1175:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1401:Cdh20 UTSW 1 104,875,222 (GRCm39) missense possibly damaging 0.65
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1502:Cdh20 UTSW 1 104,881,755 (GRCm39) missense probably benign 0.06
R1587:Cdh20 UTSW 1 110,027,757 (GRCm39) missense probably damaging 0.98
R1728:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1729:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1730:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1739:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1762:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1764:Cdh20 UTSW 1 104,862,070 (GRCm39) splice site probably benign
R1769:Cdh20 UTSW 1 109,980,606 (GRCm39) missense probably damaging 1.00
R1783:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1785:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1940:Cdh20 UTSW 1 109,976,754 (GRCm39) missense probably benign 0.09
R1972:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1973:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1997:Cdh20 UTSW 1 109,976,668 (GRCm39) missense probably damaging 1.00
R2060:Cdh20 UTSW 1 109,976,607 (GRCm39) missense probably damaging 1.00
R2068:Cdh20 UTSW 1 110,065,666 (GRCm39) nonsense probably null
R2069:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R2137:Cdh20 UTSW 1 110,027,836 (GRCm39) missense probably damaging 0.97
R2155:Cdh20 UTSW 1 109,976,594 (GRCm39) missense probably damaging 1.00
R2198:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104,875,139 (GRCm39) missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104,902,740 (GRCm39) missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104,875,199 (GRCm39) missense probably damaging 1.00
R3780:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3781:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3782:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R4115:Cdh20 UTSW 1 110,066,039 (GRCm39) missense probably benign 0.37
R4243:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4277:Cdh20 UTSW 1 109,993,418 (GRCm39) missense probably benign 0.00
R4299:Cdh20 UTSW 1 109,988,731 (GRCm39) missense probably damaging 0.99
R4349:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104,862,035 (GRCm39) missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104,912,410 (GRCm39) missense probably damaging 0.99
R4777:Cdh20 UTSW 1 109,922,055 (GRCm39) nonsense probably null
R4795:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4907:Cdh20 UTSW 1 110,066,053 (GRCm39) missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104,912,528 (GRCm39) missense probably damaging 1.00
R5045:Cdh20 UTSW 1 110,026,080 (GRCm39) missense probably benign 0.01
R5056:Cdh20 UTSW 1 104,881,722 (GRCm39) missense probably benign 0.00
R5059:Cdh20 UTSW 1 109,993,430 (GRCm39) missense probably damaging 0.98
R5127:Cdh20 UTSW 1 104,875,073 (GRCm39) missense probably damaging 1.00
R5146:Cdh20 UTSW 1 109,922,042 (GRCm39) missense probably damaging 0.97
R5196:Cdh20 UTSW 1 110,065,730 (GRCm39) missense probably damaging 0.99
R5269:Cdh20 UTSW 1 104,861,882 (GRCm39) missense possibly damaging 0.67
R5304:Cdh20 UTSW 1 110,036,569 (GRCm39) missense probably damaging 1.00
R5496:Cdh20 UTSW 1 109,976,647 (GRCm39) missense probably damaging 1.00
R5563:Cdh20 UTSW 1 104,875,082 (GRCm39) missense probably benign 0.29
R5634:Cdh20 UTSW 1 104,902,800 (GRCm39) missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104,912,635 (GRCm39) missense probably damaging 1.00
R5743:Cdh20 UTSW 1 110,036,575 (GRCm39) missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104,861,823 (GRCm39) start codon destroyed probably null 0.49
R5867:Cdh20 UTSW 1 109,976,581 (GRCm39) missense probably damaging 1.00
R5933:Cdh20 UTSW 1 104,912,396 (GRCm39) missense probably damaging 1.00
R6042:Cdh20 UTSW 1 110,065,997 (GRCm39) missense probably damaging 0.97
R6092:Cdh20 UTSW 1 110,026,036 (GRCm39) missense probably benign 0.00
R6109:Cdh20 UTSW 1 104,921,739 (GRCm39) missense probably damaging 1.00
R6497:Cdh20 UTSW 1 109,993,528 (GRCm39) critical splice donor site probably null
R6521:Cdh20 UTSW 1 104,869,859 (GRCm39) missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104,912,411 (GRCm39) missense possibly damaging 0.95
R7111:Cdh20 UTSW 1 110,065,638 (GRCm39) missense
R7169:Cdh20 UTSW 1 104,875,078 (GRCm39) missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104,921,702 (GRCm39) missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104,881,796 (GRCm39) missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104,898,598 (GRCm39) missense probably benign
R7511:Cdh20 UTSW 1 109,925,583 (GRCm39) intron probably benign
R7532:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R7535:Cdh20 UTSW 1 104,902,768 (GRCm39) missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104,869,004 (GRCm39) missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104,869,024 (GRCm39) missense probably damaging 1.00
R7879:Cdh20 UTSW 1 109,976,677 (GRCm39) missense probably benign 0.01
R7879:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104,861,898 (GRCm39) missense probably benign 0.15
R7925:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
R7978:Cdh20 UTSW 1 109,921,835 (GRCm39) start gained probably benign
R8022:Cdh20 UTSW 1 109,988,838 (GRCm39) missense probably benign 0.02
R8207:Cdh20 UTSW 1 109,922,076 (GRCm39) missense probably damaging 1.00
R8224:Cdh20 UTSW 1 109,921,933 (GRCm39) missense probably benign
R8239:Cdh20 UTSW 1 110,027,832 (GRCm39) missense probably benign 0.11
R8257:Cdh20 UTSW 1 104,921,962 (GRCm39) missense probably benign 0.25
R8444:Cdh20 UTSW 1 104,898,583 (GRCm39) missense probably benign 0.16
R8546:Cdh20 UTSW 1 104,861,769 (GRCm39) start gained probably benign
R8749:Cdh20 UTSW 1 110,027,009 (GRCm39) missense probably damaging 1.00
R8870:Cdh20 UTSW 1 104,873,048 (GRCm39) missense probably damaging 0.99
R8884:Cdh20 UTSW 1 110,027,860 (GRCm39) missense probably damaging 1.00
R9030:Cdh20 UTSW 1 110,027,843 (GRCm39) missense probably benign 0.21
R9310:Cdh20 UTSW 1 104,875,061 (GRCm39) missense probably damaging 1.00
R9498:Cdh20 UTSW 1 109,976,635 (GRCm39) missense probably benign 0.03
R9542:Cdh20 UTSW 1 104,875,067 (GRCm39) missense probably damaging 1.00
R9602:Cdh20 UTSW 1 104,868,823 (GRCm39) missense probably benign 0.07
R9658:Cdh20 UTSW 1 109,988,785 (GRCm39) missense probably damaging 0.99
R9664:Cdh20 UTSW 1 104,862,065 (GRCm39) missense probably benign 0.10
Z1088:Cdh20 UTSW 1 110,012,853 (GRCm39) missense probably benign 0.01
Z1176:Cdh20 UTSW 1 110,036,466 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGCACTTCCTTGTCGCAG -3'
(R):5'- CTGGTGTGGACATGATGTTGATCATGAA -3'

Sequencing Primer
(F):5'- GTGCATGGTTACACTCTCAACAG -3'
(R):5'- atgaggagcaagccagtaag -3'
Posted On 2013-04-16