Incidental Mutation 'R2170:Olfr298'
ID237429
Institutional Source Beutler Lab
Gene Symbol Olfr298
Ensembl Gene ENSMUSG00000062878
Gene Nameolfactory receptor 298
SynonymsGA_x6K02T2NHDJ-9619796-9620794, MOR219-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2170 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86486322-86492484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86488570 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 327 (H327L)
Ref Sequence ENSEMBL: ENSMUSP00000150228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077800] [ENSMUST00000213223] [ENSMUST00000216968] [ENSMUST00000217110]
Predicted Effect probably benign
Transcript: ENSMUST00000077800
AA Change: H327L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000076973
Gene: ENSMUSG00000062878
AA Change: H327L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.2e-37 PFAM
Pfam:7tm_1 39 288 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213223
AA Change: H327L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216968
AA Change: H327L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217110
AA Change: H327L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik A G 8: 116,971,157 S404P probably damaging Het
4933434E20Rik T A 3: 90,056,304 L89Q probably benign Het
9330182L06Rik A G 5: 9,479,206 D221G probably damaging Het
AI481877 A G 4: 59,069,215 L737S possibly damaging Het
Atxn2l T A 7: 126,503,239 probably benign Het
Bcl6 A G 16: 23,974,930 F89S probably damaging Het
Ccr1l1 C A 9: 123,978,135 V92F possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Chrne T C 11: 70,618,497 N86S probably damaging Het
Copg2 CCTCATC CC 6: 30,812,822 probably null Het
Eps8l2 T C 7: 141,342,071 S21P probably benign Het
Glb1 CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT CCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 9: 114,473,805 probably benign Het
Gm8251 A T 1: 44,056,008 S1977T probably benign Het
Gngt2 A G 11: 95,837,245 probably benign Het
Hecw2 T A 1: 53,942,797 E135V probably damaging Het
Hmcn2 G A 2: 31,380,281 A1177T probably benign Het
Itga10 T C 3: 96,650,457 V272A probably damaging Het
Kif17 A G 4: 138,288,371 I418M probably benign Het
Knl1 T C 2: 119,087,594 probably null Het
Lamc1 C T 1: 153,249,142 A628T probably benign Het
Mag A T 7: 30,908,987 L234* probably null Het
Muc5ac T A 7: 141,812,347 V2080E possibly damaging Het
Myo18b T C 5: 112,723,858 D2119G probably benign Het
Ncam1 C T 9: 49,798,681 A17T probably benign Het
Nipbl A G 15: 8,293,218 Y2570H probably damaging Het
Oasl2 T C 5: 114,906,800 V129A probably damaging Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Podn A T 4: 108,022,533 L85Q probably damaging Het
Ppp1r12c A T 7: 4,482,806 D680E possibly damaging Het
Prdm14 G A 1: 13,122,460 L352F probably damaging Het
Prob1 G T 18: 35,654,737 Q155K probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Stard5 A G 7: 83,633,158 T60A probably benign Het
Syt7 A G 19: 10,439,380 K402E probably damaging Het
Tll2 T A 19: 41,183,275 D69V probably damaging Het
Vmn1r40 T C 6: 89,714,975 F258S probably benign Het
Zfp759 T A 13: 67,136,748 Y19N possibly damaging Het
Other mutations in Olfr298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr298 APN 7 86489557 utr 5 prime probably benign
IGL01603:Olfr298 APN 7 86488931 missense possibly damaging 0.92
IGL02389:Olfr298 APN 7 86489128 missense probably damaging 0.98
IGL03146:Olfr298 APN 7 86489194 missense probably damaging 1.00
R0680:Olfr298 UTSW 7 86489337 missense probably benign
R0834:Olfr298 UTSW 7 86489490 missense probably benign 0.11
R1132:Olfr298 UTSW 7 86489217 missense probably benign 0.03
R1519:Olfr298 UTSW 7 86489125 missense probably damaging 0.99
R1881:Olfr298 UTSW 7 86489438 missense probably benign 0.01
R4500:Olfr298 UTSW 7 86488919 missense probably benign 0.00
R4524:Olfr298 UTSW 7 86488826 missense probably damaging 1.00
R5184:Olfr298 UTSW 7 86489291 frame shift probably null
R5521:Olfr298 UTSW 7 86488631 missense probably benign 0.08
R7448:Olfr298 UTSW 7 86489209 missense probably damaging 1.00
R7643:Olfr298 UTSW 7 86489568 critical splice acceptor site probably null
R7688:Olfr298 UTSW 7 86488975 missense probably benign 0.01
R8104:Olfr298 UTSW 7 86489023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTACTGCAATCAAGGC -3'
(R):5'- AGGCTGTTTTCTGTGCTACAC -3'

Sequencing Primer
(F):5'- TACTGCAATCAAGGCCGGGTG -3'
(R):5'- ACACACTGTGTTGCCTCCAG -3'
Posted On2014-10-02