Incidental Mutation 'R0173:Srrm2'
ID23743
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 23815129 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: A249E
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: A249E

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189977
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: A345E
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: A345E

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Meta Mutation Damage Score 0.0987 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hdac3 A G 18: 37,941,753 S312P probably damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
BB009:Srrm2 UTSW 17 23818527 missense probably benign 0.23
BB019:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7644:Srrm2 UTSW 17 23819320 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
R7874:Srrm2 UTSW 17 23815678 missense unknown
R7932:Srrm2 UTSW 17 23818527 missense probably benign 0.23
R7950:Srrm2 UTSW 17 23808110 missense unknown
R7958:Srrm2 UTSW 17 23821312 missense probably benign 0.25
R8081:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8118:Srrm2 UTSW 17 23808083 missense unknown
R8174:Srrm2 UTSW 17 23815323 missense unknown
R8191:Srrm2 UTSW 17 23820245 missense probably damaging 1.00
R8334:Srrm2 UTSW 17 23808356 missense unknown
RF006:Srrm2 UTSW 17 23812588 missense unknown
Z1176:Srrm2 UTSW 17 23817183 missense unknown
Z1177:Srrm2 UTSW 17 23817510 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCCAGTATGCAAAATGGAGACAG -3'
(R):5'- GCCGAGAACCTTTGGTAGGTTGAG -3'

Sequencing Primer
(F):5'- ggttttctctttgccacctc -3'
(R):5'- CTTAGGTGGTGAACAGCCC -3'
Posted On2013-04-16