Incidental Mutation 'R2171:Phc3'
ID237465
Institutional Source Beutler Lab
Gene Symbol Phc3
Ensembl Gene ENSMUSG00000037652
Gene Namepolyhomeotic 3
SynonymsHPH3, EDR3, E030046K01Rik
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location30899371-30969415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30950929 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 172 (T172A)
Ref Sequence ENSEMBL: ENSMUSP00000037862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000064718] [ENSMUST00000099163] [ENSMUST00000108255] [ENSMUST00000129817] [ENSMUST00000152357] [ENSMUST00000168645] [ENSMUST00000177992]
Predicted Effect probably damaging
Transcript: ENSMUST00000046624
AA Change: T172A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652
AA Change: T172A

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064718
AA Change: T172A

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065617
Gene: ENSMUSG00000037652
AA Change: T172A

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 470 496 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 541 571 N/A INTRINSIC
low complexity region 610 618 N/A INTRINSIC
low complexity region 628 656 N/A INTRINSIC
PDB:2L8E|A 745 781 1e-8 PDB
low complexity region 849 868 N/A INTRINSIC
SAM 884 951 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099163
AA Change: T172A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096767
Gene: ENSMUSG00000037652
AA Change: T172A

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 300 326 N/A INTRINSIC
low complexity region 360 386 N/A INTRINSIC
low complexity region 479 505 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 550 580 N/A INTRINSIC
low complexity region 619 627 N/A INTRINSIC
low complexity region 637 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108255
AA Change: T160A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103890
Gene: ENSMUSG00000037652
AA Change: T160A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129817
AA Change: T160A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114916
Gene: ENSMUSG00000037652
AA Change: T160A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.7e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152357
AA Change: T172A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117614
Gene: ENSMUSG00000037652
AA Change: T172A

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 201 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168645
AA Change: T160A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652
AA Change: T160A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177992
AA Change: T160A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136820
Gene: ENSMUSG00000037652
AA Change: T160A

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Phc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Phc3 APN 3 30936475 missense probably damaging 0.98
IGL00985:Phc3 APN 3 30914197 missense probably benign 0.13
IGL01340:Phc3 APN 3 30929884 missense possibly damaging 0.85
IGL01450:Phc3 APN 3 30914504 missense probably damaging 1.00
IGL01546:Phc3 APN 3 30961739 missense probably damaging 1.00
IGL01918:Phc3 APN 3 30914416 critical splice donor site probably null
IGL02178:Phc3 APN 3 30929863 missense possibly damaging 0.47
IGL02210:Phc3 APN 3 30936709 missense probably damaging 0.99
IGL02330:Phc3 APN 3 30936381 missense probably damaging 1.00
IGL02516:Phc3 APN 3 30948793 missense probably damaging 1.00
IGL03030:Phc3 APN 3 30936853 missense probably damaging 1.00
See_saw UTSW 3 30937049 nonsense probably null
R1228:Phc3 UTSW 3 30922255 missense possibly damaging 0.71
R1239:Phc3 UTSW 3 30914130 missense probably damaging 1.00
R1319:Phc3 UTSW 3 30929869 missense probably damaging 0.97
R1521:Phc3 UTSW 3 30936575 missense possibly damaging 0.89
R1772:Phc3 UTSW 3 30961820 missense probably damaging 1.00
R1793:Phc3 UTSW 3 30948716 missense probably damaging 1.00
R1879:Phc3 UTSW 3 30914458 missense probably damaging 1.00
R2419:Phc3 UTSW 3 30950878 missense probably damaging 0.99
R2863:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R2864:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R3700:Phc3 UTSW 3 30914128 missense probably damaging 1.00
R3980:Phc3 UTSW 3 30936931 missense probably damaging 0.99
R4222:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4223:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4584:Phc3 UTSW 3 30965882 missense possibly damaging 0.46
R4928:Phc3 UTSW 3 30950919 missense probably damaging 1.00
R5100:Phc3 UTSW 3 30922199 missense possibly damaging 0.71
R5340:Phc3 UTSW 3 30907467 missense probably damaging 1.00
R5656:Phc3 UTSW 3 30965866 missense probably damaging 0.98
R5840:Phc3 UTSW 3 30936583 missense possibly damaging 0.95
R6022:Phc3 UTSW 3 30930025 missense probably damaging 1.00
R6061:Phc3 UTSW 3 30914529 missense probably damaging 1.00
R6177:Phc3 UTSW 3 30942565 missense probably damaging 1.00
R6188:Phc3 UTSW 3 30937049 nonsense probably null
R6866:Phc3 UTSW 3 30914531 nonsense probably null
R6870:Phc3 UTSW 3 30936761 missense probably damaging 1.00
R7155:Phc3 UTSW 3 30914197 missense probably benign 0.01
X0025:Phc3 UTSW 3 30965886 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTAAGCATATGCACACAC -3'
(R):5'- AGTTGCCCACAGTAGAGGGTTC -3'

Sequencing Primer
(F):5'- GCATATGCACACACTTGTTAACTC -3'
(R):5'- AAGATCAGAGCCGCTCTTTG -3'
Posted On2014-10-02