Incidental Mutation 'R0173:Hdac3'
ID23747
Institutional Source Beutler Lab
Gene Symbol Hdac3
Ensembl Gene ENSMUSG00000024454
Gene Namehistone deacetylase 3
Synonyms
MMRRC Submission 038445-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0173 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location37935844-37954988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37941753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 312 (S312P)
Ref Sequence ENSEMBL: ENSMUSP00000037981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043498]
Predicted Effect probably damaging
Transcript: ENSMUST00000043498
AA Change: S312P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454
AA Change: S312P

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Meta Mutation Damage Score 0.9274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.1%
Validation Efficiency 96% (64/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene results in embryonic death at or around the time of gastrulation. Structural and functional abnormalities are also reported in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330008L17Rik G A 8: 99,421,654 noncoding transcript Het
Akt1s1 C T 7: 44,852,860 P95S possibly damaging Het
Ambra1 T C 2: 91,810,219 probably benign Het
Aunip T A 4: 134,523,550 W269R probably damaging Het
Bmper A G 9: 23,224,829 M69V probably benign Het
Cdh2 A T 18: 16,650,257 probably benign Het
Cenpe T C 3: 135,259,983 M2074T probably benign Het
Col14a1 C T 15: 55,488,532 P1592S probably damaging Het
Csgalnact1 G A 8: 68,461,029 R175C probably damaging Het
Dtx1 A G 5: 120,682,753 probably benign Het
Elmod3 T C 6: 72,577,588 D154G probably damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Gab1 T C 8: 80,800,160 D103G possibly damaging Het
Gon4l A G 3: 88,858,403 D377G probably damaging Het
Gramd1c C T 16: 43,997,833 R328K possibly damaging Het
Hmcn2 T C 2: 31,438,331 probably null Het
Intu T C 3: 40,675,346 probably null Het
Lnpk T C 2: 74,551,065 K118R probably damaging Het
Lzts3 A C 2: 130,634,768 *587G probably null Het
Mctp2 C T 7: 72,247,107 probably null Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp23 G T 4: 155,650,765 R374S possibly damaging Het
Morc3 G A 16: 93,832,206 probably null Het
Mymk C T 2: 27,062,250 A161T probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Neb T C 2: 52,243,847 S3375G probably damaging Het
Nedd1 T C 10: 92,698,883 D255G probably benign Het
Nid2 T C 14: 19,802,332 probably benign Het
Nr1d2 A G 14: 18,215,502 probably benign Het
Nus1 A G 10: 52,417,998 H86R possibly damaging Het
Olfr1474 A T 19: 13,471,701 I244F probably benign Het
Olfr829 A G 9: 18,857,029 I135V probably damaging Het
Plcxd2 A T 16: 45,965,179 probably null Het
Prdm9 T A 17: 15,544,013 D835V probably benign Het
Prdm9 A G 17: 15,544,035 W828R probably benign Het
Prkd2 T C 7: 16,849,044 S244P probably benign Het
Psmd4 A T 3: 95,032,923 L159H probably damaging Het
Qprt C T 7: 127,108,371 G215E probably damaging Het
Rab3gap2 C A 1: 185,249,907 H385Q possibly damaging Het
Rapgef5 A G 12: 117,688,676 D300G probably benign Het
Rbl1 A T 2: 157,159,685 N894K probably benign Het
Rgma C T 7: 73,417,554 R280W probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rundc3a T A 11: 102,398,245 probably benign Het
Scaf11 A T 15: 96,420,194 D496E probably benign Het
Scn9a T C 2: 66,533,093 Y936C probably damaging Het
Sdk1 A G 5: 142,173,809 probably benign Het
Serpinb9 G A 13: 33,010,722 D154N probably benign Het
Slc48a1 A T 15: 97,790,674 H131L possibly damaging Het
Slco1a6 T C 6: 142,103,122 N311D probably benign Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Srrm2 C A 17: 23,815,129 probably benign Het
Srsf12 A T 4: 33,226,117 S122C probably damaging Het
Suclg2 G C 6: 95,475,173 probably benign Het
Tbpl1 A T 10: 22,707,624 L149* probably null Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem63a T C 1: 180,954,798 probably benign Het
Tut1 C T 19: 8,965,483 R645* probably null Het
Ubqln4 T A 3: 88,555,379 D50E probably benign Het
Ubr5 A G 15: 38,004,675 S1227P probably damaging Het
Vipas39 A G 12: 87,250,511 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps26b G A 9: 27,012,805 T214I probably benign Het
Xpc A G 6: 91,504,735 probably benign Het
Other mutations in Hdac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hdac3 APN 18 37954885 missense possibly damaging 0.95
IGL00570:Hdac3 APN 18 37944121 splice site probably benign
IGL01511:Hdac3 APN 18 37952595 missense probably benign 0.16
IGL01559:Hdac3 APN 18 37943672 splice site probably benign
IGL01688:Hdac3 APN 18 37954879 missense possibly damaging 0.53
IGL02529:Hdac3 APN 18 37944132 missense probably benign 0.20
IGL02559:Hdac3 APN 18 37954891 missense probably damaging 1.00
IGL02702:Hdac3 APN 18 37941094 missense probably benign 0.00
PIT4520001:Hdac3 UTSW 18 37941764 missense probably damaging 1.00
R0325:Hdac3 UTSW 18 37940952 critical splice donor site probably null
R0445:Hdac3 UTSW 18 37943724 missense probably damaging 0.99
R1341:Hdac3 UTSW 18 37954713 missense probably damaging 1.00
R2068:Hdac3 UTSW 18 37943516 missense probably damaging 1.00
R2761:Hdac3 UTSW 18 37945726 missense probably benign 0.19
R3805:Hdac3 UTSW 18 37945692 critical splice donor site probably null
R4467:Hdac3 UTSW 18 37952513 missense probably benign 0.03
R5928:Hdac3 UTSW 18 37941341 intron probably benign
R5929:Hdac3 UTSW 18 37941341 intron probably benign
R6341:Hdac3 UTSW 18 37944164 missense probably damaging 0.99
R6679:Hdac3 UTSW 18 37944933 missense possibly damaging 0.59
R6843:Hdac3 UTSW 18 37941954 missense probably benign
R7262:Hdac3 UTSW 18 37945563 missense probably damaging 0.99
R7559:Hdac3 UTSW 18 37945516 missense possibly damaging 0.94
R7585:Hdac3 UTSW 18 37945355 missense probably damaging 1.00
R7652:Hdac3 UTSW 18 37954919 unclassified probably benign
R8434:Hdac3 UTSW 18 37941422 missense possibly damaging 0.68
Z1177:Hdac3 UTSW 18 37945751 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTGAGACACCAGAGTGAATCC -3'
(R):5'- GCTACACTGTCCGAAATGTTGCCC -3'

Sequencing Primer
(F):5'- CTGGTCCCCATGTGTAAGAG -3'
(R):5'- CGGTGTTGGTGAGTGTTCTG -3'
Posted On2013-04-16