Mutagenetix > Incidental Mutation

Incidental Mutation 'R2171:Col9a2'

237471

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040173-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2171 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 121045001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 173 (C173*)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000030372
AA Change: C173*

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: C173*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151987

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abt1	A	G	13: 23,422,217	L189P	probably damaging	Het
Adgrl3	C	A	5: 81,512,515	S377*	probably null	Het
Adgrv1	A	G	13: 81,270,918	V5986A	probably damaging	Het
Arv1	T	G	8: 124,728,355	C102W	probably damaging	Het
Asb18	T	C	1: 89,968,697	H207R	probably benign	Het
Bach2	T	C	4: 32,501,662	V13A	probably damaging	Het
Bccip	T	C	7: 133,719,114	S206P	probably benign	Het
Cdhr4	T	C	9: 107,992,918	S41P	probably benign	Het
Chd7	A	G	4: 8,752,424	Y307C	probably damaging	Het
Clec4f	A	T	6: 83,652,864	S237R	possibly damaging	Het
Cntnap5a	A	G	1: 116,188,402	D538G	possibly damaging	Het
Ctr9	T	A	7: 111,046,910	M703K	possibly damaging	Het
Cyp2a12	A	G	7: 27,029,632	Y83C	probably damaging	Het
Eef1akmt3	A	C	10: 127,032,974	D210E	probably benign	Het
Erbin	A	G	13: 103,834,958	F717L	probably benign	Het
Gtf3a	A	G	5: 146,955,462	N341S	probably benign	Het
Hltf	T	C	3: 20,059,081	V6A	probably damaging	Het
Itga6	T	A	2: 71,820,014	Y135N	probably damaging	Het
Krt73	T	C	15: 101,800,910	Q154R	possibly damaging	Het
Lce1a1	C	T	3: 92,646,741	C142Y	unknown	Het
Lcorl	A	T	5: 45,747,151	I112N	probably damaging	Het
Ltbp1	C	T	17: 75,291,317	H916Y	probably damaging	Het
Lypla2	T	C	4: 135,970,604		probably null	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mmp1a	T	A	9: 7,475,356	D375E	probably damaging	Het
Nlrp14	T	G	7: 107,182,502	L302R	probably damaging	Het
Npy2r	T	G	3: 82,540,401	T243P	possibly damaging	Het
Olfr633	T	C	7: 103,946,785	V73A	probably damaging	Het
Olfr749	A	T	14: 50,736,419	S248T	probably benign	Het
Paqr9	A	T	9: 95,560,878	H307L	probably damaging	Het
Phc3	T	C	3: 30,950,929	T172A	probably damaging	Het
Pigs	A	G	11: 78,328,812	T39A	probably damaging	Het
Pik3c2g	C	T	6: 139,855,286	Q386*	probably null	Het
Pira2	T	C	7: 3,844,418	S91G	probably benign	Het
Plxna2	T	A	1: 194,800,617	N1539K	probably damaging	Het
Poc5	C	T	13: 96,410,749	H507Y	probably damaging	Het
Pou2f1	A	T	1: 165,880,356		probably benign	Het
Pthlh	T	G	6: 147,257,196	K89Q	probably damaging	Het
Rims4	A	T	2: 163,864,126		probably null	Het
Rnf138	A	G	18: 21,026,086	N188D	probably damaging	Het
Rreb1	A	G	13: 37,930,846	D727G	probably benign	Het
Sc5d	T	G	9: 42,255,386	K286Q	probably benign	Het
Slc10a5	C	T	3: 10,335,282	G106D	possibly damaging	Het
Smg6	A	T	11: 75,038,646	Q967L	probably damaging	Het
Spty2d1	C	T	7: 46,994,613	R636H	probably damaging	Het
Srms	A	T	2: 181,208,780	Y195*	probably null	Het
Susd4	A	G	1: 182,892,194	D458G	probably benign	Het
Tecta	T	C	9: 42,358,924	R1363G	probably damaging	Het
Thbs1	G	A	2: 118,122,579	G890D	probably damaging	Het
Tpp2	T	C	1: 43,957,446	V317A	probably benign	Het
Ttpa	T	C	4: 20,021,357	V175A	probably damaging	Het
Vps13b	G	T	15: 35,887,197	D3251Y	probably benign	Het
Vps54	A	G	11: 21,298,810	D441G	probably benign	Het
Zfp738	A	T	13: 67,670,977	Y298*	probably null	Het
Zfp804a	G	A	2: 82,257,183	C452Y	possibly damaging	Het
Zxdc	A	G	6: 90,382,479	K698E	possibly damaging	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4067:Col9a2	UTSW	4	121052389	missense	probably damaging	1.00
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCACATCTCCTCTCAGGGC -3'
(R):5'- AGGAGGCAGATCTCTGTAGG -3'

Sequencing Primer
(F):5'- ATCTCCTCTCAGGGCCGACC -3'
(R):5'- GCAGATCTCTGTAGGATTGTCTCC -3'

Posted On

2014-10-02