Incidental Mutation 'R2171:Adgrl3'
ID237476
Institutional Source Beutler Lab
Gene Symbol Adgrl3
Ensembl Gene ENSMUSG00000037605
Gene Nameadhesion G protein-coupled receptor L3
SynonymsLEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location81020138-81825133 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81512515 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 377 (S377*)
Ref Sequence ENSEMBL: ENSMUSP00000113600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000120673] [ENSMUST00000121641] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000122356] [ENSMUST00000132375]
Predicted Effect probably null
Transcript: ENSMUST00000036068
AA Change: S377*
SMART Domains Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 6.6e-27 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 1.1e-7 PFAM
Pfam:DUF3497 627 857 2.2e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 4.4e-72 PFAM
Pfam:Latrophilin 1206 1276 2.4e-30 PFAM
Pfam:Latrophilin 1272 1543 3.2e-113 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072521
AA Change: S377*
SMART Domains Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 5.9e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.3e-8 PFAM
Pfam:GAIN 630 856 1.2e-58 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 2.5e-73 PFAM
Pfam:Latrophilin 1207 1274 4e-34 PFAM
Pfam:Latrophilin 1272 1543 5e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117253
AA Change: S309*
SMART Domains Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5e-73 PFAM
Pfam:Latrophilin 1129 1265 7.5e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117407
AA Change: S377*
SMART Domains Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.4e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 6e-8 PFAM
Pfam:DUF3497 627 857 2.6e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7.7e-73 PFAM
Pfam:Latrophilin 1197 1321 1.8e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117985
AA Change: S309*
SMART Domains Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.3e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.7e-72 PFAM
Pfam:Latrophilin 1138 1512 6.8e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118034
AA Change: S309*
SMART Domains Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.5e-8 PFAM
Pfam:DUF3497 559 789 1.6e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.6e-73 PFAM
Pfam:Latrophilin 1129 1503 6.7e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118078
AA Change: S309*
SMART Domains Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.7e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.3e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 4.8e-73 PFAM
Pfam:Latrophilin 1129 1201 2.6e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118442
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.7e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-72 PFAM
Pfam:Latrophilin 1206 1278 2.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119385
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 4.6e-8 PFAM
Pfam:DUF3497 627 857 1.3e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 5.2e-73 PFAM
Pfam:Latrophilin 1197 1269 2.7e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119788
AA Change: S377*
SMART Domains Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.7e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-72 PFAM
Pfam:Latrophilin 1206 1279 3.6e-31 PFAM
Pfam:Latrophilin 1273 1550 4.5e-113 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120128
AA Change: S309*
SMART Domains Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 9.8e-27 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.4e-8 PFAM
Pfam:DUF3497 559 789 1.2e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1210 2.6e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120144
AA Change: S309*
SMART Domains Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 5.1e-73 PFAM
Pfam:Latrophilin 1129 1253 8.4e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120292
AA Change: S309*
SMART Domains Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 4.5e-8 PFAM
Pfam:DUF3497 559 789 1.3e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1119 1.3e-72 PFAM
Pfam:Latrophilin 1138 1262 8.5e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120445
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.2e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 2.8e-8 PFAM
Pfam:GAIN 630 856 5.1e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.4e-73 PFAM
Pfam:Latrophilin 1207 1328 8e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120673
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.7e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 3.3e-8 PFAM
Pfam:GAIN 630 856 6.4e-59 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1187 1.8e-73 PFAM
Pfam:Latrophilin 1207 1580 1.4e-158 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121641
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.8e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 7e-73 PFAM
Pfam:Latrophilin 1197 1571 7.3e-178 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121707
AA Change: S377*
SMART Domains Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 1.3e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 5.6e-8 PFAM
Pfam:DUF3497 627 857 1.7e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 6.8e-73 PFAM
Pfam:Latrophilin 1197 1267 6.4e-30 PFAM
Pfam:Latrophilin 1263 1534 8.7e-113 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122037
AA Change: S309*
SMART Domains Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: S309*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gal_Lectin 43 123 1.2e-26 PFAM
OLF 137 393 2.71e-170 SMART
low complexity region 426 448 N/A INTRINSIC
Pfam:HRM 495 553 5.3e-8 PFAM
Pfam:DUF3497 559 789 1.5e-84 PFAM
GPS 814 866 3.72e-25 SMART
Pfam:7tm_2 874 1110 6.3e-73 PFAM
Pfam:Latrophilin 1129 1199 4.4e-30 PFAM
Pfam:Latrophilin 1194 1460 1.3e-112 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122356
AA Change: S377*
SMART Domains Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: S377*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 62 87 N/A INTRINSIC
Pfam:Gal_Lectin 111 191 2.8e-26 PFAM
OLF 205 461 2.71e-170 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:HRM 563 621 7e-8 PFAM
Pfam:DUF3497 627 857 3.1e-84 PFAM
GPS 882 934 3.72e-25 SMART
Pfam:7tm_2 942 1178 9.3e-73 PFAM
Pfam:Latrophilin 1197 1267 9e-30 PFAM
Pfam:Latrophilin 1262 1528 2.8e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127046
Predicted Effect probably benign
Transcript: ENSMUST00000132375
SMART Domains Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153264
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Adgrl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Adgrl3 APN 5 81724224 missense probably damaging 0.99
IGL00596:Adgrl3 APN 5 81646467 missense probably benign 0.01
IGL00766:Adgrl3 APN 5 81794568 missense probably damaging 1.00
IGL00787:Adgrl3 APN 5 81693554 missense probably damaging 1.00
IGL00917:Adgrl3 APN 5 81693574 missense possibly damaging 0.93
IGL01155:Adgrl3 APN 5 81560893 missense probably benign 0.39
IGL01348:Adgrl3 APN 5 81726723 missense probably damaging 1.00
IGL01401:Adgrl3 APN 5 81688669 missense possibly damaging 0.94
IGL01443:Adgrl3 APN 5 81465287 missense probably damaging 1.00
IGL01532:Adgrl3 APN 5 81694569 missense probably damaging 1.00
IGL01779:Adgrl3 APN 5 81387870 missense probably damaging 1.00
IGL01920:Adgrl3 APN 5 81465296 missense probably damaging 1.00
IGL02065:Adgrl3 APN 5 81512217 missense probably damaging 1.00
IGL02365:Adgrl3 APN 5 81512581 missense probably damaging 1.00
IGL02879:Adgrl3 APN 5 81512119 missense probably damaging 1.00
R0010:Adgrl3 UTSW 5 81792403 missense possibly damaging 0.58
R0077:Adgrl3 UTSW 5 81771685 splice site probably benign
R0103:Adgrl3 UTSW 5 81792347 intron probably benign
R0138:Adgrl3 UTSW 5 81693607 missense probably damaging 1.00
R0149:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0349:Adgrl3 UTSW 5 81771644 missense probably damaging 1.00
R0361:Adgrl3 UTSW 5 81760697 missense probably damaging 1.00
R0522:Adgrl3 UTSW 5 81726801 missense possibly damaging 0.91
R0610:Adgrl3 UTSW 5 81693716 splice site probably benign
R0658:Adgrl3 UTSW 5 81648713 missense probably benign 0.18
R0671:Adgrl3 UTSW 5 81560905 missense probably benign 0.45
R0679:Adgrl3 UTSW 5 81794977 missense probably damaging 1.00
R1413:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R1444:Adgrl3 UTSW 5 81512353 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1574:Adgrl3 UTSW 5 81787449 missense probably damaging 1.00
R1738:Adgrl3 UTSW 5 81387979 missense probably damaging 0.99
R1744:Adgrl3 UTSW 5 81794420 missense probably damaging 1.00
R1803:Adgrl3 UTSW 5 81771617 nonsense probably null
R1891:Adgrl3 UTSW 5 81512044 missense probably damaging 1.00
R1988:Adgrl3 UTSW 5 81688567 missense probably damaging 1.00
R2126:Adgrl3 UTSW 5 81512536 missense probably damaging 1.00
R2136:Adgrl3 UTSW 5 81512254 missense probably damaging 1.00
R2891:Adgrl3 UTSW 5 81693519 missense probably damaging 1.00
R3508:Adgrl3 UTSW 5 81724256 missense probably damaging 1.00
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3732:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3733:Adgrl3 UTSW 5 81794946 missense probably benign 0.05
R3982:Adgrl3 UTSW 5 81694526 missense possibly damaging 0.95
R4085:Adgrl3 UTSW 5 81512544 missense probably benign 0.02
R4462:Adgrl3 UTSW 5 81688510 missense probably damaging 1.00
R4725:Adgrl3 UTSW 5 81766205 missense possibly damaging 0.67
R4726:Adgrl3 UTSW 5 81646578 missense possibly damaging 0.61
R4781:Adgrl3 UTSW 5 81760724 missense probably damaging 1.00
R4837:Adgrl3 UTSW 5 81766234 missense probably benign 0.07
R4841:Adgrl3 UTSW 5 81794271 missense possibly damaging 0.53
R4883:Adgrl3 UTSW 5 81689646 missense probably damaging 1.00
R4921:Adgrl3 UTSW 5 81512110 missense probably damaging 1.00
R4945:Adgrl3 UTSW 5 81512048 missense probably damaging 1.00
R5055:Adgrl3 UTSW 5 81646551 missense possibly damaging 0.48
R5313:Adgrl3 UTSW 5 81726669 missense probably damaging 1.00
R5385:Adgrl3 UTSW 5 81726801 missense probably damaging 1.00
R5447:Adgrl3 UTSW 5 81465341 intron probably benign
R5482:Adgrl3 UTSW 5 81794513 missense probably damaging 1.00
R5586:Adgrl3 UTSW 5 81724147 missense probably damaging 0.99
R5637:Adgrl3 UTSW 5 81693544 missense probably damaging 1.00
R5919:Adgrl3 UTSW 5 81646570 missense probably benign 0.00
R6090:Adgrl3 UTSW 5 81512326 missense probably damaging 1.00
R6093:Adgrl3 UTSW 5 81646522 missense probably benign 0.42
R6107:Adgrl3 UTSW 5 81688563 missense probably damaging 0.97
R6245:Adgrl3 UTSW 5 81688556 missense probably benign 0.01
R6426:Adgrl3 UTSW 5 81726870 missense probably damaging 1.00
R6440:Adgrl3 UTSW 5 81794494 nonsense probably null
R6516:Adgrl3 UTSW 5 81465272 missense probably damaging 1.00
R6527:Adgrl3 UTSW 5 81787517 missense probably damaging 0.99
R6622:Adgrl3 UTSW 5 81794759 missense probably benign 0.34
R6842:Adgrl3 UTSW 5 81741080 missense probably damaging 1.00
R6902:Adgrl3 UTSW 5 81689587 missense probably damaging 1.00
R6921:Adgrl3 UTSW 5 81648713 missense probably damaging 0.99
R7201:Adgrl3 UTSW 5 81724222 missense probably damaging 1.00
R7207:Adgrl3 UTSW 5 81310027 start codon destroyed probably null 0.33
R7215:Adgrl3 UTSW 5 81693550 missense probably damaging 1.00
R7376:Adgrl3 UTSW 5 81794750 missense probably damaging 1.00
R7441:Adgrl3 UTSW 5 81724140 missense possibly damaging 0.70
R7582:Adgrl3 UTSW 5 81693676 missense probably damaging 0.99
R7682:Adgrl3 UTSW 5 81794560 missense probably damaging 0.97
Z1088:Adgrl3 UTSW 5 81329882 missense probably benign 0.33
Z1088:Adgrl3 UTSW 5 81512158 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCAACAAGGAGCGGACAAG -3'
(R):5'- ATCCACAGCTGCTATGTACTGG -3'

Sequencing Primer
(F):5'- TGCTAATTACCATGACACCTCC -3'
(R):5'- CCACAGCTGCTATGTACTGGTAAGAG -3'
Posted On2014-10-02