Incidental Mutation 'R2171:Cdhr4'
ID237495
Institutional Source Beutler Lab
Gene Symbol Cdhr4
Ensembl Gene ENSMUSG00000032595
Gene Namecadherin-related family member 4
SynonymsCdh29, 1700021K14Rik, D330022A01Rik
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107992497-107999684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107992918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000135184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175759] [ENSMUST00000176306] [ENSMUST00000176373] [ENSMUST00000177173] [ENSMUST00000177368] [ENSMUST00000177508]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175729
Predicted Effect probably benign
Transcript: ENSMUST00000175759
SMART Domains Protein: ENSMUSP00000135743
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 3 104 4e-44 BLAST
SCOP:d1l3wa3 59 104 4e-7 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175802
SMART Domains Protein: ENSMUSP00000135003
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
CA 33 116 5.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176196
Predicted Effect probably benign
Transcript: ENSMUST00000176306
Predicted Effect probably benign
Transcript: ENSMUST00000176334
Predicted Effect probably benign
Transcript: ENSMUST00000176373
SMART Domains Protein: ENSMUSP00000134896
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177093
Predicted Effect probably benign
Transcript: ENSMUST00000177173
AA Change: S41P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135184
Gene: ENSMUSG00000032595
AA Change: S41P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Blast:CA 149 224 2e-9 BLAST
Blast:CA 252 330 3e-33 BLAST
CA 354 437 2.24e-1 SMART
CA 459 542 5.86e-17 SMART
Blast:CA 566 649 3e-40 BLAST
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177226
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177508
SMART Domains Protein: ENSMUSP00000135332
Gene: ENSMUSG00000032595

DomainStartEndE-ValueType
Blast:CA 1 29 4e-7 BLAST
transmembrane domain 60 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177516
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 A G 13: 23,422,217 L189P probably damaging Het
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Cdhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdhr4 APN 9 107999545 missense probably damaging 1.00
IGL01105:Cdhr4 APN 9 107995861 unclassified probably benign
IGL02097:Cdhr4 APN 9 107993000 missense probably benign 0.17
IGL02441:Cdhr4 APN 9 107993267 missense possibly damaging 0.84
IGL02635:Cdhr4 APN 9 107992871 missense probably benign 0.04
IGL02870:Cdhr4 APN 9 107998064 critical splice donor site probably null
IGL03160:Cdhr4 APN 9 107995869 missense probably benign 0.05
IGL03162:Cdhr4 APN 9 107998011 missense probably damaging 1.00
IGL03250:Cdhr4 APN 9 107996659 missense probably damaging 0.99
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R0233:Cdhr4 UTSW 9 107996934 missense probably benign 0.25
R1241:Cdhr4 UTSW 9 107995296 missense probably benign 0.00
R1250:Cdhr4 UTSW 9 107997516 missense probably damaging 1.00
R2102:Cdhr4 UTSW 9 107998007 missense probably damaging 1.00
R2104:Cdhr4 UTSW 9 107996261 missense probably damaging 0.97
R2106:Cdhr4 UTSW 9 107997494 missense possibly damaging 0.75
R2108:Cdhr4 UTSW 9 107997644 missense probably damaging 1.00
R2312:Cdhr4 UTSW 9 107995287 missense probably benign 0.00
R4106:Cdhr4 UTSW 9 107996260 missense probably damaging 1.00
R4515:Cdhr4 UTSW 9 107992951 missense probably benign 0.31
R4686:Cdhr4 UTSW 9 107995684 missense probably benign 0.00
R4799:Cdhr4 UTSW 9 107998699 splice site probably benign
R5165:Cdhr4 UTSW 9 107997630 missense probably damaging 1.00
R5478:Cdhr4 UTSW 9 107995591 missense possibly damaging 0.61
R5574:Cdhr4 UTSW 9 107993328 unclassified probably benign
R7387:Cdhr4 UTSW 9 107996912 nonsense probably null
R7609:Cdhr4 UTSW 9 107997283 missense probably damaging 0.99
R7663:Cdhr4 UTSW 9 107998772 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGTGTCACCTGTAGGAG -3'
(R):5'- CTGTGGTGGATCGACAAAAGAC -3'

Sequencing Primer
(F):5'- GACAAGGAAGGACTTTGGCTGC -3'
(R):5'- AGGGCCTAGGCTTTCTGTCTC -3'
Posted On2014-10-02