Incidental Mutation 'R0178:Arfgap2'
ID23750
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91267361 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 141 (A141V)
Ref Sequence ENSEMBL: ENSMUSP00000078920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000028694] [ENSMUST00000059566] [ENSMUST00000080008] [ENSMUST00000111349] [ENSMUST00000168916]
Predicted Effect probably benign
Transcript: ENSMUST00000028691
AA Change: A141V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255
AA Change: A141V

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028694
SMART Domains Protein: ENSMUSP00000028694
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059566
SMART Domains Protein: ENSMUSP00000054391
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080008
AA Change: A141V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255
AA Change: A141V

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111349
SMART Domains Protein: ENSMUSP00000106981
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128296
Predicted Effect probably benign
Transcript: ENSMUST00000128684
SMART Domains Protein: ENSMUSP00000118915
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
PDB:3SYV|H 2 61 3e-37 PDB
low complexity region 62 74 N/A INTRINSIC
SCOP:d1k4us_ 86 112 6e-7 SMART
PDB:2X3X|E 88 112 7e-7 PDB
Blast:SH3 91 112 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150753
Predicted Effect probably benign
Transcript: ENSMUST00000168916
SMART Domains Protein: ENSMUSP00000129175
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0927:Arfgap2 UTSW 2 91273805 missense probably benign 0.05
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5249:Arfgap2 UTSW 2 91265637 nonsense probably null
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6261:Arfgap2 UTSW 2 91270282 missense probably benign 0.00
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
R7531:Arfgap2 UTSW 2 91273744 splice site probably null
R8058:Arfgap2 UTSW 2 91266299 critical splice donor site probably null
R8121:Arfgap2 UTSW 2 91265683 missense probably benign 0.01
R8179:Arfgap2 UTSW 2 91275323 missense probably damaging 1.00
Z1177:Arfgap2 UTSW 2 91275104 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAATATACGAGCCGAGCTGCCCAG -3'
(R):5'- CCAAGGTGCTCACAGATACAACAGG -3'

Sequencing Primer
(F):5'- TGCCCAGATGTACCGAGAG -3'
(R):5'- gacttagccacatcacagaaatac -3'
Posted On2013-04-16