Incidental Mutation 'R2171:Abt1'
ID237502
Institutional Source Beutler Lab
Gene Symbol Abt1
Ensembl Gene ENSMUSG00000036376
Gene Nameactivator of basal transcription 1
Synonyms
MMRRC Submission 040173-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2171 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23418361-23423866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23422217 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 189 (L189P)
Ref Sequence ENSEMBL: ENSMUSP00000045888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041782]
Predicted Effect probably damaging
Transcript: ENSMUST00000041782
AA Change: L189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045888
Gene: ENSMUSG00000036376
AA Change: L189P

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
low complexity region 36 44 N/A INTRINSIC
Blast:RRM 49 141 9e-34 BLAST
SCOP:d1fxla1 50 137 4e-3 SMART
coiled coil region 166 194 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Basal transcription of genes by RNA polymerase II requires the interaction of TATA-binding protein (TBP) with the core region of class II promoters. Studies in mouse suggest that the protein encoded by this gene likely activates basal transcription from class II promoters by interaction with TBP and the class II promoter DNA. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 C A 5: 81,512,515 S377* probably null Het
Adgrv1 A G 13: 81,270,918 V5986A probably damaging Het
Arv1 T G 8: 124,728,355 C102W probably damaging Het
Asb18 T C 1: 89,968,697 H207R probably benign Het
Bach2 T C 4: 32,501,662 V13A probably damaging Het
Bccip T C 7: 133,719,114 S206P probably benign Het
Cdhr4 T C 9: 107,992,918 S41P probably benign Het
Chd7 A G 4: 8,752,424 Y307C probably damaging Het
Clec4f A T 6: 83,652,864 S237R possibly damaging Het
Cntnap5a A G 1: 116,188,402 D538G possibly damaging Het
Col9a2 T A 4: 121,045,001 C173* probably null Het
Ctr9 T A 7: 111,046,910 M703K possibly damaging Het
Cyp2a12 A G 7: 27,029,632 Y83C probably damaging Het
Eef1akmt3 A C 10: 127,032,974 D210E probably benign Het
Erbin A G 13: 103,834,958 F717L probably benign Het
Gtf3a A G 5: 146,955,462 N341S probably benign Het
Hltf T C 3: 20,059,081 V6A probably damaging Het
Itga6 T A 2: 71,820,014 Y135N probably damaging Het
Krt73 T C 15: 101,800,910 Q154R possibly damaging Het
Lce1a1 C T 3: 92,646,741 C142Y unknown Het
Lcorl A T 5: 45,747,151 I112N probably damaging Het
Ltbp1 C T 17: 75,291,317 H916Y probably damaging Het
Lypla2 T C 4: 135,970,604 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mmp1a T A 9: 7,475,356 D375E probably damaging Het
Nlrp14 T G 7: 107,182,502 L302R probably damaging Het
Npy2r T G 3: 82,540,401 T243P possibly damaging Het
Olfr633 T C 7: 103,946,785 V73A probably damaging Het
Olfr749 A T 14: 50,736,419 S248T probably benign Het
Paqr9 A T 9: 95,560,878 H307L probably damaging Het
Phc3 T C 3: 30,950,929 T172A probably damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Pik3c2g C T 6: 139,855,286 Q386* probably null Het
Pira2 T C 7: 3,844,418 S91G probably benign Het
Plxna2 T A 1: 194,800,617 N1539K probably damaging Het
Poc5 C T 13: 96,410,749 H507Y probably damaging Het
Pou2f1 A T 1: 165,880,356 probably benign Het
Pthlh T G 6: 147,257,196 K89Q probably damaging Het
Rims4 A T 2: 163,864,126 probably null Het
Rnf138 A G 18: 21,026,086 N188D probably damaging Het
Rreb1 A G 13: 37,930,846 D727G probably benign Het
Sc5d T G 9: 42,255,386 K286Q probably benign Het
Slc10a5 C T 3: 10,335,282 G106D possibly damaging Het
Smg6 A T 11: 75,038,646 Q967L probably damaging Het
Spty2d1 C T 7: 46,994,613 R636H probably damaging Het
Srms A T 2: 181,208,780 Y195* probably null Het
Susd4 A G 1: 182,892,194 D458G probably benign Het
Tecta T C 9: 42,358,924 R1363G probably damaging Het
Thbs1 G A 2: 118,122,579 G890D probably damaging Het
Tpp2 T C 1: 43,957,446 V317A probably benign Het
Ttpa T C 4: 20,021,357 V175A probably damaging Het
Vps13b G T 15: 35,887,197 D3251Y probably benign Het
Vps54 A G 11: 21,298,810 D441G probably benign Het
Zfp738 A T 13: 67,670,977 Y298* probably null Het
Zfp804a G A 2: 82,257,183 C452Y possibly damaging Het
Zxdc A G 6: 90,382,479 K698E possibly damaging Het
Other mutations in Abt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Abt1 APN 13 23423768 missense unknown
IGL01917:Abt1 APN 13 23423789 missense unknown
FR4548:Abt1 UTSW 13 23423711 small deletion probably benign
FR4976:Abt1 UTSW 13 23423711 small deletion probably benign
PIT4486001:Abt1 UTSW 13 23423681 missense possibly damaging 0.87
R0029:Abt1 UTSW 13 23422508 missense possibly damaging 0.85
R4082:Abt1 UTSW 13 23422146 missense probably benign 0.00
R5125:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5178:Abt1 UTSW 13 23422649 missense possibly damaging 0.75
R5204:Abt1 UTSW 13 23422668 missense probably damaging 1.00
R5947:Abt1 UTSW 13 23422055 missense possibly damaging 0.55
R6562:Abt1 UTSW 13 23423588 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGGGCTCCAAAGATCTTG -3'
(R):5'- TCTGAGCAGCTCCCAGTTTC -3'

Sequencing Primer
(F):5'- AAGGAGCCCTCTGTTGGATC -3'
(R):5'- GAGCAGCTCCCAGTTTCTTCTC -3'
Posted On2014-10-02