Mutagenetix > Incidental Mutation

Incidental Mutation 'R2172:Dnah7b'

237516

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

040174-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46124512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 492 (Y492C)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069293
AA Change: Y492C

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: Y492C

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46142149	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46211337	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46224651	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46066729	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46214322	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46195378	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46081432	splice site	probably benign
IGL01392:Dnah7b	APN	1	46126788	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46116300	splice site	probably benign
IGL01460:Dnah7b	APN	1	46139704	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46268653	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46358147	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46358137	nonsense	probably null
IGL01906:Dnah7b	APN	1	46175453	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46124337	splice site	probably benign
IGL01989:Dnah7b	APN	1	46289534	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46139875	missense	probably benign
IGL02213:Dnah7b	APN	1	46233592	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46226930	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46099503	nonsense	probably null
IGL02381:Dnah7b	APN	1	46277120	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46234193	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46195318	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46123777	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46116301	splice site	probably benign
IGL02704:Dnah7b	APN	1	46142133	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46099608	splice site	probably benign
IGL02745:Dnah7b	APN	1	46195029	splice site	probably benign
IGL02818:Dnah7b	APN	1	46290808	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46119298	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46182375	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46085689	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46119304	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46373348	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46213360	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46223178	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46219348	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46123777	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46207643	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46134656	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46240944	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46277126	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46236788	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46140176	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46219544	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46240992	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46340132	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46099612	splice site	probably benign
R1035:Dnah7b	UTSW	1	46124448	missense	probably benign
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46325810	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46340120	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46099509	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46289656	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46078593	splice site	probably benign
R1484:Dnah7b	UTSW	1	46137543	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46177281	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46066797	missense	unknown
R1607:Dnah7b	UTSW	1	46290646	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46352966	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46175390	nonsense	probably null
R1681:Dnah7b	UTSW	1	46324712	nonsense	probably null
R1716:Dnah7b	UTSW	1	46191783	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46233759	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46116177	missense	probably benign	0.04
R1838:Dnah7b	UTSW	1	46277105	missense	probably damaging	1.00
R1898:Dnah7b	UTSW	1	46236714	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46242103	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46142087	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46242321	nonsense	probably null
R2083:Dnah7b	UTSW	1	46241067	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46097992	splice site	probably benign
R2239:Dnah7b	UTSW	1	46201184	splice site	probably benign
R2247:Dnah7b	UTSW	1	46277063	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46233915	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46362954	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46195287	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46139741	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46207572	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46188687	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46182423	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46268709	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46352873	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46299875	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46243257	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46137485	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46233711	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46081495	missense	probably benign
R4172:Dnah7b	UTSW	1	46226946	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46137418	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46221772	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46337594	splice site	probably null
R4414:Dnah7b	UTSW	1	46126680	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46085632	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46289536	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46078524	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46217157	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46211328	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46207656	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46066955	missense	unknown
R4780:Dnah7b	UTSW	1	46353014	missense	probably benign
R4828:Dnah7b	UTSW	1	46128112	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46356602	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46195074	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46081444	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46201318	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46290775	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46233726	missense	probably benign
R5000:Dnah7b	UTSW	1	46099503	nonsense	probably null
R5005:Dnah7b	UTSW	1	46242028	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46187363	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46182380	nonsense	probably null
R5174:Dnah7b	UTSW	1	46243349	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46358216	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46233858	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46373354	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46233689	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46217191	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46188659	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46358271	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46242206	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46242019	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46109312	missense	probably null
R5479:Dnah7b	UTSW	1	46223105	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46242199	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46356514	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46268764	splice site	probably null
R5659:Dnah7b	UTSW	1	46352849	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46233992	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46277120	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46142132	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46191725	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46337593	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46221643	missense	probably benign
R5941:Dnah7b	UTSW	1	46187290	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46362987	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46119398	splice site	probably null
R6041:Dnah7b	UTSW	1	46289645	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46139789	missense	probably benign
R6049:Dnah7b	UTSW	1	46085602	missense	probably benign
R6131:Dnah7b	UTSW	1	46253466	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46290703	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46233585	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46126668	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46225888	missense	probably benign
R6273:Dnah7b	UTSW	1	46242316	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46340175	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46242204	nonsense	probably null
R6494:Dnah7b	UTSW	1	46099431	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46224742	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46340217	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46191788	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46195120	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46119268	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46358238	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46195139	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46236809	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46352813	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46139710	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46126804	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46242142	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46139966	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46083754	missense	probably benign
R7244:Dnah7b	UTSW	1	46277143	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46142085	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46195372	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46303634	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46175419	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46290734	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46325765	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46356554	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46124346	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46214413	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46268634	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46109302	missense	probably benign
R7676:Dnah7b	UTSW	1	46234164	nonsense	probably null
R7731:Dnah7b	UTSW	1	46139745	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46201253	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46137474	missense	probably benign
R7807:Dnah7b	UTSW	1	46214367	missense	probably benign
R7895:Dnah7b	UTSW	1	46249950	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46139678	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46227003	missense	probably benign
R7946:Dnah7b	UTSW	1	46233579	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46243424	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46243365	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46224706	nonsense	probably null
R8094:Dnah7b	UTSW	1	46126804	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46233753	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46253511	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46356576	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46139872	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46175296	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46356659	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46188679	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46290715	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46099490	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46116200	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46175438	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46182464	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46352999	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46123646	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46234145	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46191793	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46241076	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46253374	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46223072	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46243415	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46134514	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46227020	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46142034	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46290878	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46322260	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46233754	nonsense	probably null
R9392:Dnah7b	UTSW	1	46123738	nonsense	probably null
R9456:Dnah7b	UTSW	1	46126793	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46214404	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46225796	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46253461	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46213384	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46337594	splice site	probably null
RF020:Dnah7b	UTSW	1	46373261	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46373298	nonsense	probably null
X0023:Dnah7b	UTSW	1	46303577	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCTGGCGTAATTTTCATTCACAAC -3'
(R):5'- GTTGATATGAAGAACCCATAAGCAG -3'

Sequencing Primer
(F):5'- TTCATTCACAACAATTGATCTCCAC -3'
(R):5'- TATGAAGAACCCATAAGCAGAAAAC -3'

Posted On

2014-10-02