Incidental Mutation 'R2172:Il15ra'
ID 237519
Institutional Source Beutler Lab
Gene Symbol Il15ra
Ensembl Gene ENSMUSG00000023206
Gene Name interleukin 15 receptor, alpha chain
Synonyms
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2172 (G1)
Quality Score 209
Status Not validated
Chromosome 2
Chromosomal Location 11705290-11734317 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11723571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 149 (T149A)
Ref Sequence ENSEMBL: ENSMUSP00000110480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078834] [ENSMUST00000114831] [ENSMUST00000114832] [ENSMUST00000114833] [ENSMUST00000114834] [ENSMUST00000123600] [ENSMUST00000128156] [ENSMUST00000135341] [ENSMUST00000138349] [ENSMUST00000138856] [ENSMUST00000148748]
AlphaFold Q60819
Predicted Effect possibly damaging
Transcript: ENSMUST00000078834
AA Change: T182A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077878
Gene: ENSMUSG00000023206
AA Change: T182A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091456
Predicted Effect possibly damaging
Transcript: ENSMUST00000114831
AA Change: T149A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110480
Gene: ENSMUSG00000023206
AA Change: T149A

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114832
SMART Domains Protein: ENSMUSP00000110481
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114833
SMART Domains Protein: ENSMUSP00000110482
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114834
SMART Domains Protein: ENSMUSP00000110483
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CCP 36 96 3.87e-8 SMART
low complexity region 107 117 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123600
AA Change: T94A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130792
Gene: ENSMUSG00000023206
AA Change: T94A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126394
SMART Domains Protein: ENSMUSP00000131640
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128156
AA Change: T42A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126364
Gene: ENSMUSG00000023206
AA Change: T42A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133975
Predicted Effect possibly damaging
Transcript: ENSMUST00000135341
AA Change: T42A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132731
Gene: ENSMUSG00000023206
AA Change: T42A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138349
AA Change: T42A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131473
Gene: ENSMUSG00000023206
AA Change: T42A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138856
SMART Domains Protein: ENSMUSP00000120539
Gene: ENSMUSG00000023206

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PDB:2PSM|C 34 59 1e-11 PDB
Blast:CCP 36 59 3e-9 BLAST
low complexity region 64 73 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148748
AA Change: T42A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132058
Gene: ENSMUSG00000023206
AA Change: T42A

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139774
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mutation of this gene results in absence of NK cell production in spleen and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Il15ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Il15ra APN 2 11733145 splice site probably benign
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0105:Il15ra UTSW 2 11730648 critical splice donor site probably null
R0945:Il15ra UTSW 2 11718327 missense probably damaging 0.96
R1863:Il15ra UTSW 2 11723436 missense possibly damaging 0.85
R1975:Il15ra UTSW 2 11723523 missense possibly damaging 0.94
R2202:Il15ra UTSW 2 11718344 critical splice donor site probably null
R3709:Il15ra UTSW 2 11730647 critical splice donor site probably null
R3710:Il15ra UTSW 2 11730647 critical splice donor site probably null
R4621:Il15ra UTSW 2 11718329 missense possibly damaging 0.95
R4701:Il15ra UTSW 2 11718345 splice site probably null
R4779:Il15ra UTSW 2 11718306 missense probably damaging 0.98
R4844:Il15ra UTSW 2 11718271 start gained probably benign
R5237:Il15ra UTSW 2 11733205 missense possibly damaging 0.91
R5810:Il15ra UTSW 2 11733252 splice site probably null
R5880:Il15ra UTSW 2 11730615 makesense probably null
R6160:Il15ra UTSW 2 11720016 missense probably damaging 0.99
R7291:Il15ra UTSW 2 11718381 missense probably damaging 0.99
R7788:Il15ra UTSW 2 11723593 missense probably damaging 0.99
R8941:Il15ra UTSW 2 11733184 missense possibly damaging 0.94
R9013:Il15ra UTSW 2 11727765 missense probably benign 0.00
R9025:Il15ra UTSW 2 11718422 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTTGGAATTTCCTGCAGAGC -3'
(R):5'- CTTACAGTGGGGATTGCAATAACC -3'

Sequencing Primer
(F):5'- TTTCCTGCAGAGCCAGAAG -3'
(R):5'- GTGGGGATTGCAATAACCAACTAACC -3'
Posted On 2014-10-02