Incidental Mutation 'R2172:Fastkd1'
ID 237522
Institutional Source Beutler Lab
Gene Symbol Fastkd1
Ensembl Gene ENSMUSG00000027086
Gene Name FAST kinase domains 1
Synonyms 5330408N05Rik
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69686815-69713516 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69700133 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 560 (S560P)
Ref Sequence ENSEMBL: ENSMUSP00000099767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000102706]
AlphaFold Q6DI86
Predicted Effect probably damaging
Transcript: ENSMUST00000073152
AA Change: S589P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086
AA Change: S589P

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 560 628 6.6e-25 PFAM
Pfam:FAST_2 645 730 6.4e-26 PFAM
RAP 763 822 4.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102706
AA Change: S560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086
AA Change: S560P

DomainStartEndE-ValueType
low complexity region 179 191 N/A INTRINSIC
low complexity region 316 324 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
Pfam:FAST_1 530 600 2.2e-26 PFAM
Pfam:FAST_2 614 701 4.4e-31 PFAM
RAP 734 793 4.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140776
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Fastkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fastkd1 APN 2 69707549 missense probably benign 0.02
IGL00702:Fastkd1 APN 2 69708545 missense probably damaging 0.99
IGL00960:Fastkd1 APN 2 69694653 splice site probably benign
IGL01154:Fastkd1 APN 2 69690060 splice site probably null
IGL01463:Fastkd1 APN 2 69690061 critical splice donor site probably null
IGL01913:Fastkd1 APN 2 69708501 splice site probably benign
IGL01977:Fastkd1 APN 2 69694588 missense possibly damaging 0.64
IGL02408:Fastkd1 APN 2 69702601 missense probably benign
IGL02715:Fastkd1 APN 2 69712125 critical splice donor site probably null
IGL03411:Fastkd1 APN 2 69707359 missense probably damaging 0.99
PIT4519001:Fastkd1 UTSW 2 69690157 missense probably damaging 0.97
R0541:Fastkd1 UTSW 2 69702406 missense probably damaging 1.00
R0612:Fastkd1 UTSW 2 69712383 missense probably benign 0.03
R1170:Fastkd1 UTSW 2 69708649 splice site probably benign
R1499:Fastkd1 UTSW 2 69708638 critical splice acceptor site probably null
R1586:Fastkd1 UTSW 2 69712148 missense probably benign 0.43
R1698:Fastkd1 UTSW 2 69702469 missense probably benign 0.22
R2240:Fastkd1 UTSW 2 69696953 missense probably benign 0.01
R2327:Fastkd1 UTSW 2 69705528 nonsense probably null
R2897:Fastkd1 UTSW 2 69702616 missense probably damaging 1.00
R4120:Fastkd1 UTSW 2 69707310 missense probably damaging 0.98
R4544:Fastkd1 UTSW 2 69712311 missense probably damaging 1.00
R4546:Fastkd1 UTSW 2 69712311 missense probably damaging 1.00
R4798:Fastkd1 UTSW 2 69691307 missense probably benign 0.38
R4993:Fastkd1 UTSW 2 69702740 missense probably damaging 0.99
R5284:Fastkd1 UTSW 2 69712188 missense probably benign 0.01
R5668:Fastkd1 UTSW 2 69707381 missense possibly damaging 0.92
R6869:Fastkd1 UTSW 2 69702760 missense probably benign 0.02
R6870:Fastkd1 UTSW 2 69708614 missense probably benign 0.05
R7062:Fastkd1 UTSW 2 69704322 missense possibly damaging 0.74
R7576:Fastkd1 UTSW 2 69694644 missense probably damaging 1.00
R7644:Fastkd1 UTSW 2 69696840 splice site probably null
R7971:Fastkd1 UTSW 2 69707359 missense probably benign 0.19
R8336:Fastkd1 UTSW 2 69712145 missense probably damaging 1.00
R8403:Fastkd1 UTSW 2 69687081 nonsense probably null
R8422:Fastkd1 UTSW 2 69702434 missense probably damaging 1.00
R9041:Fastkd1 UTSW 2 69702371 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCTTCTGCCTCACCAAG -3'
(R):5'- AGGTTAATAAGCGGGACATCTG -3'

Sequencing Primer
(F):5'- GAGCTGGAATTTCGAAAACCATC -3'
(R):5'- AAGCGGGACATCTGTACTTTCAC -3'
Posted On 2014-10-02