Incidental Mutation 'R2172:Atp1a1'
ID237531
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene NameATPase, Na+/K+ transporting, alpha 1 polypeptide
SynonymsAtpa-1
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location101576219-101604684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101590548 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 308 (I308L)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
Predicted Effect probably benign
Transcript: ENSMUST00000036493
AA Change: I308L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I308L

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136340
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAAGAGGTTCATGGCTGAG -3'
(R):5'- GCACATTTTCTGGCCTCTGG -3'

Sequencing Primer
(F):5'- GCTGAGCCCTGTACCCACAC -3'
(R):5'- TCTGGCTGACACGATCCC -3'
Posted On2014-10-02