Mutagenetix > Incidental Mutation

Incidental Mutation 'R2172:Atp1a1'

237531

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101590548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 308 (I308L)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably benign
Transcript: ENSMUST00000036493
AA Change: I308L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I308L

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCAAGAGGTTCATGGCTGAG -3'
(R):5'- GCACATTTTCTGGCCTCTGG -3'

Sequencing Primer
(F):5'- GCTGAGCCCTGTACCCACAC -3'
(R):5'- TCTGGCTGACACGATCCC -3'

Posted On

2014-10-02