Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Virma'

237532

Institutional Source

Beutler Lab

Gene Symbol

Virma

Ensembl Gene

ENSMUSG00000040720

Gene Name

vir like m6A methyltransferase associated

Synonyms

1110037F02Rik

MMRRC Submission

040174-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11485958-11550684 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11527843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1245 (M1245L)

Ref Sequence

ENSEMBL: ENSMUSP00000103943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055372] [ENSMUST00000059914] [ENSMUST00000108307]

AlphaFold

A2AIV2

Predicted Effect

probably benign
Transcript: ENSMUST00000055372

SMART Domains

Protein: ENSMUSP00000063188
Gene: ENSMUSG00000040720

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000059914
AA Change: M1195L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: M1195L

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1224	1232	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC
low complexity region	1460	1474	N/A	INTRINSIC
low complexity region	1618	1634	N/A	INTRINSIC
low complexity region	1684	1697	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
low complexity region	1796	1808	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108307
AA Change: M1245L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: M1245L

Domain	Start	End	E-Value	Type
Pfam:VIR_N	5	266	2e-110	PFAM
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1058	1070	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1274	1282	N/A	INTRINSIC
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1668	1684	N/A	INTRINSIC
low complexity region	1734	1747	N/A	INTRINSIC
low complexity region	1800	1807	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ibsp	T	C	5: 104,310,430	Y278H	probably damaging	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Virma

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Virma	APN	4	11519424	splice site	probably benign
IGL00477:Virma	APN	4	11519006	missense	probably damaging	0.99
IGL01293:Virma	APN	4	11521114	missense	probably damaging	1.00
IGL01410:Virma	APN	4	11518929	nonsense	probably null
IGL01531:Virma	APN	4	11528753	missense	probably damaging	1.00
IGL01672:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL01724:Virma	APN	4	11528672	missense	probably damaging	1.00
IGL01747:Virma	APN	4	11526877	missense	probably damaging	1.00
IGL01776:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL02064:Virma	APN	4	11513163	missense	possibly damaging	0.87
IGL02243:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02244:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02445:Virma	APN	4	11527029	missense	probably damaging	0.97
IGL02546:Virma	APN	4	11494804	missense	probably damaging	0.99
IGL02807:Virma	APN	4	11507079	splice site	probably benign
IGL02967:Virma	APN	4	11514096	missense	probably benign	0.01
IGL03211:Virma	APN	4	11548770	nonsense	probably null
IGL03242:Virma	APN	4	11527669	missense	possibly damaging	0.70
IGL03256:Virma	APN	4	11542207	splice site	probably benign
IGL03327:Virma	APN	4	11518984	missense	probably benign	0.00
IGL03346:Virma	APN	4	11518984	missense	probably benign	0.00
PIT4802001:Virma	UTSW	4	11546008	missense	probably damaging	0.99
R0142:Virma	UTSW	4	11548783	missense	probably benign	0.04
R0355:Virma	UTSW	4	11528626	nonsense	probably null
R0522:Virma	UTSW	4	11519416	critical splice donor site	probably null
R0600:Virma	UTSW	4	11498769	missense	probably damaging	0.99
R1435:Virma	UTSW	4	11528621	missense	probably damaging	1.00
R1489:Virma	UTSW	4	11521164	missense	probably damaging	1.00
R1568:Virma	UTSW	4	11528776	missense	probably damaging	0.99
R1616:Virma	UTSW	4	11544954	missense	probably damaging	1.00
R1655:Virma	UTSW	4	11494786	missense	probably damaging	1.00
R1695:Virma	UTSW	4	11494814	missense	probably damaging	0.98
R1835:Virma	UTSW	4	11540511	missense	probably benign	0.02
R1951:Virma	UTSW	4	11513907	missense	probably benign	0.00
R1991:Virma	UTSW	4	11519242	missense	probably benign	0.06
R2145:Virma	UTSW	4	11548726	splice site	probably benign
R2217:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2218:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2248:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R2342:Virma	UTSW	4	11501316	missense	probably damaging	1.00
R3424:Virma	UTSW	4	11513177	nonsense	probably null
R4397:Virma	UTSW	4	11513901	missense	possibly damaging	0.81
R4449:Virma	UTSW	4	11498828	critical splice donor site	probably null
R4660:Virma	UTSW	4	11513505	missense	probably damaging	1.00
R4698:Virma	UTSW	4	11528636	missense	probably damaging	0.99
R4878:Virma	UTSW	4	11544971	missense	probably damaging	1.00
R4937:Virma	UTSW	4	11521147	nonsense	probably null
R5031:Virma	UTSW	4	11542116	nonsense	probably null
R5040:Virma	UTSW	4	11528746	missense	probably benign	0.01
R5061:Virma	UTSW	4	11494840	missense	possibly damaging	0.95
R5091:Virma	UTSW	4	11519392	missense	probably benign	0.00
R5137:Virma	UTSW	4	11546297	missense	probably damaging	1.00
R5262:Virma	UTSW	4	11539926	missense	probably benign	0.01
R5297:Virma	UTSW	4	11494819	missense	probably damaging	1.00
R5730:Virma	UTSW	4	11542154	missense	probably benign	0.44
R5818:Virma	UTSW	4	11513319	missense	possibly damaging	0.92
R5835:Virma	UTSW	4	11514036	missense	probably damaging	1.00
R6125:Virma	UTSW	4	11521172	missense	probably damaging	0.98
R6197:Virma	UTSW	4	11505498	missense	probably damaging	0.96
R6222:Virma	UTSW	4	11527820	missense	probably damaging	1.00
R6793:Virma	UTSW	4	11539968	missense	probably damaging	1.00
R7028:Virma	UTSW	4	11519249	missense	possibly damaging	0.50
R7356:Virma	UTSW	4	11513595	missense	probably damaging	0.99
R7383:Virma	UTSW	4	11514026	missense	probably damaging	0.98
R7391:Virma	UTSW	4	11508099	missense	probably damaging	0.99
R7425:Virma	UTSW	4	11546211	missense	possibly damaging	0.95
R7556:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11549682	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11513016	splice site	probably null
R7986:Virma	UTSW	4	11540023	missense	probably benign	0.01
R7990:Virma	UTSW	4	11513983	missense	probably benign	0.00
R8048:Virma	UTSW	4	11539918	nonsense	probably null
R8050:Virma	UTSW	4	11528643	missense	probably benign	0.22
R8412:Virma	UTSW	4	11521261	critical splice donor site	probably null
R8544:Virma	UTSW	4	11516949	missense	probably benign
R8551:Virma	UTSW	4	11513397	missense	probably damaging	1.00
R8699:Virma	UTSW	4	11528678	missense	probably benign	0.04
R8739:Virma	UTSW	4	11540643	critical splice donor site	probably null
R8950:Virma	UTSW	4	11519047	nonsense	probably null
R9015:Virma	UTSW	4	11540494	missense	probably benign	0.27
R9038:Virma	UTSW	4	11526922	missense	possibly damaging	0.93
R9115:Virma	UTSW	4	11498744	missense	probably benign	0.15
R9294:Virma	UTSW	4	11513507	nonsense	probably null
X0020:Virma	UTSW	4	11486055	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TATCAGTGGCACTCAACACC -3'
(R):5'- GACCTTCAACATGACTTACACATG -3'

Sequencing Primer
(F):5'- CCCGAAAATTGTGGAGCATGC -3'
(R):5'- TCAACATGACTTACACATGAAATGAG -3'

Posted On

2014-10-02