Incidental Mutation 'R2172:Ccdc158'
ID237542
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2172 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92632508 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 902 (L902H)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930]
Predicted Effect probably damaging
Transcript: ENSMUST00000060930
AA Change: L902H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: L902H

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212060
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAAAGGAGCATGTGGAC -3'
(R):5'- TCAGAACCACTGCAAATCCTATTG -3'

Sequencing Primer
(F):5'- GGAGCATGTGGACCACTTAATG -3'
(R):5'- CTGGGTGTGAGCCAAATGAC -3'
Posted On2014-10-02