Mutagenetix > Incidental Mutations

Incidental Mutation 'R2172:Ibsp'

237543

Institutional Source

Beutler Lab

Gene Symbol

Ibsp

Ensembl Gene

ENSMUSG00000029306

Gene Name

integrin binding sialoprotein

Synonyms

Bsp2, bone sialoprotein, BSP

MMRRC Submission

040174-MU

Accession Numbers

Genbank: NM_008318.3

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R2172 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104299171-104311469 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104310430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 278 (Y278H)

Ref Sequence

ENSEMBL: ENSMUSP00000031246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031246]

AlphaFold

Q61711

Predicted Effect

probably damaging
Transcript: ENSMUST00000031246
AA Change: Y278H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306
AA Change: Y278H

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:BSP_II	17	321	2.8e-127	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap3	T	A	18: 37,990,560	E441V	probably damaging	Het
Arfip2	T	A	7: 105,637,988	D64V	probably damaging	Het
Atg9a	C	A	1: 75,185,685	R527L	probably damaging	Het
Atp1a1	T	G	3: 101,590,548	I308L	probably benign	Het
Bcan	T	A	3: 87,996,581	Y199F	probably damaging	Het
Bsn	T	C	9: 108,109,992		probably benign	Het
Ccdc158	A	T	5: 92,632,508	L902H	probably damaging	Het
Dnah7b	A	G	1: 46,124,512	Y492C	probably benign	Het
Dnah9	G	T	11: 66,072,779	H1783N	probably damaging	Het
Dpep2	A	G	8: 105,988,998	V320A	possibly damaging	Het
Dsc2	A	G	18: 20,045,502	Y282H	probably damaging	Het
Egfr	C	T	11: 16,911,562	P1114S	probably benign	Het
Fastkd1	A	G	2: 69,700,133	S560P	probably damaging	Het
Gm10696	T	G	3: 94,176,298	K69Q	possibly damaging	Het
Gm14295	G	A	2: 176,811,102	R795Q	possibly damaging	Het
Gpr155	C	T	2: 73,382,127	V51I	probably benign	Het
Gsap	G	A	5: 21,222,440		probably null	Het
Hecw1	T	A	13: 14,377,706	I103F	probably damaging	Het
Herc3	T	A	6: 58,887,437	N685K	probably damaging	Het
Hnrnph1	T	A	11: 50,382,816	D244E	probably benign	Het
Hydin	A	G	8: 110,582,049	E3989G	probably benign	Het
Ift57	T	G	16: 49,759,340	N291K	probably benign	Het
Il15ra	A	G	2: 11,723,571	T149A	possibly damaging	Het
Ints5	C	T	19: 8,896,282	T535I	possibly damaging	Het
Jarid2	T	C	13: 44,902,539	L268P	probably damaging	Het
Klhdc7a	T	A	4: 139,965,810	T609S	probably benign	Het
Lrrc49	A	G	9: 60,602,682	V429A	probably benign	Het
Lsm3	T	C	6: 91,522,272	V87A	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Map1a	G	T	2: 121,307,932	V2726L	probably damaging	Het
Marveld3	A	C	8: 109,961,846	S88A	probably benign	Het
Mcm9	T	C	10: 53,548,574	D640G	probably damaging	Het
Mettl4	A	G	17: 94,733,163	I399T	probably benign	Het
Mmp27	T	A	9: 7,577,378	L274*	probably null	Het
Nacc2	A	C	2: 26,060,223	D500E	probably benign	Het
Nprl3	T	A	11: 32,234,894	M372L	probably benign	Het
Olfr478	A	T	7: 108,031,467	I292N	probably damaging	Het
Otud7b	T	G	3: 96,153,520		probably null	Het
Pcx	G	A	19: 4,620,881	R1070H	probably benign	Het
Ptprq	C	T	10: 107,590,994	W1560*	probably null	Het
Puf60	A	T	15: 76,070,464	I520N	probably damaging	Het
Qars	C	T	9: 108,509,200	R143C	probably damaging	Het
Rfx3	G	A	19: 27,815,494	Q322*	probably null	Het
Samd14	G	T	11: 95,014,391	V10L	probably benign	Het
Setd2	G	A	9: 110,549,844	R909Q	probably benign	Het
Sh2d4a	T	C	8: 68,296,664	S117P	probably benign	Het
Sharpin	C	A	15: 76,350,666		probably benign	Het
Skor1	C	A	9: 63,145,122	A494S	possibly damaging	Het
Slc41a2	T	C	10: 83,283,774	T375A	probably benign	Het
Sparc	G	A	11: 55,395,801	Q324*	probably null	Het
Srebf1	T	C	11: 60,206,502	T171A	probably benign	Het
Srrd	A	G	5: 112,341,122	I54T	possibly damaging	Het
Tecpr1	G	T	5: 144,196,417	Q1072K	probably damaging	Het
Tecpr1	A	T	5: 144,211,456	V377E	probably benign	Het
Tln1	T	A	4: 43,545,721	H919L	probably benign	Het
Tm9sf3	C	T	19: 41,217,420	S516N	probably damaging	Het
Trpa1	T	A	1: 14,881,656	T940S	probably benign	Het
Trpv4	G	A	5: 114,644,710	R64C	probably damaging	Het
Tufm	A	G	7: 126,488,847	E174G	probably benign	Het
Urb2	A	G	8: 124,031,102	T1183A	probably damaging	Het
Virma	A	T	4: 11,527,843	M1245L	possibly damaging	Het
Vmn2r32	T	C	7: 7,474,615	Y259C	probably damaging	Het
Zfp329	A	G	7: 12,810,767	F277L	probably damaging	Het
Zfp683	C	T	4: 134,055,795	T190I	possibly damaging	Het

Other mutations in Ibsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Ibsp	APN	5	104310068	missense	probably benign	0.27
IGL02317:Ibsp	APN	5	104302466	missense	probably damaging	1.00
IGL02539:Ibsp	APN	5	104302283	missense	probably damaging	0.99
IGL03236:Ibsp	APN	5	104306005	missense	probably benign	0.30
crunch	UTSW	5	104309282	missense	probably damaging	1.00
I2289:Ibsp	UTSW	5	104302487	missense	possibly damaging	0.64
PIT4445001:Ibsp	UTSW	5	104302304	missense	possibly damaging	0.94
R0049:Ibsp	UTSW	5	104302158	missense	probably damaging	1.00
R0049:Ibsp	UTSW	5	104302158	missense	probably damaging	1.00
R0234:Ibsp	UTSW	5	104310069	small deletion	probably benign
R0610:Ibsp	UTSW	5	104310134	missense	probably benign	0.07
R0656:Ibsp	UTSW	5	104310020	critical splice acceptor site	probably null
R1168:Ibsp	UTSW	5	104302152	missense	probably damaging	0.99
R1440:Ibsp	UTSW	5	104310539	missense	unknown
R1569:Ibsp	UTSW	5	104310151	missense	probably damaging	1.00
R1921:Ibsp	UTSW	5	104310212	missense	probably damaging	1.00
R2879:Ibsp	UTSW	5	104310394	missense	possibly damaging	0.88
R4399:Ibsp	UTSW	5	104309282	missense	probably damaging	1.00
R4517:Ibsp	UTSW	5	104305997	nonsense	probably null
R5417:Ibsp	UTSW	5	104310469	missense	possibly damaging	0.95
R5575:Ibsp	UTSW	5	104310059	missense	possibly damaging	0.78
R6183:Ibsp	UTSW	5	104306030	missense	possibly damaging	0.95
R6273:Ibsp	UTSW	5	104310301	missense	probably benign	0.15
R6295:Ibsp	UTSW	5	104302121	splice site	probably null
R7061:Ibsp	UTSW	5	104309902	splice site	probably null
R7133:Ibsp	UTSW	5	104302306	nonsense	probably null
R7202:Ibsp	UTSW	5	104302161	missense	probably benign	0.02
R7205:Ibsp	UTSW	5	104310431	missense	probably damaging	0.99
R7769:Ibsp	UTSW	5	104306005	missense	probably benign	0.15
R7769:Ibsp	UTSW	5	104310184	missense	probably damaging	0.97
R8506:Ibsp	UTSW	5	104310081	missense	probably damaging	1.00
R8840:Ibsp	UTSW	5	104310140	missense	probably benign	0.00
R9396:Ibsp	UTSW	5	104310431	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCGTCACTGAAGCAGGTG -3'
(R):5'- TGCACCTTCCTGAGTTGAATTTTG -3'

Sequencing Primer
(F):5'- TCACTGAAGCAGGTGCAGAAG -3'
(R):5'- TGGGGAATTCAAATGGGGAAATTCC -3'

Posted On

2014-10-02