Incidental Mutation 'R2172:Trpv4'
ID 237545
Institutional Source Beutler Lab
Gene Symbol Trpv4
Ensembl Gene ENSMUSG00000014158
Gene Name transient receptor potential cation channel, subfamily V, member 4
Synonyms VROAC, 0610033B08Rik, Trp12, VR-OAC, VRL-2, OTRPC4
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R2172 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114622152-114658421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114644710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 64 (R64C)
Ref Sequence ENSEMBL: ENSMUSP00000107838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071968] [ENSMUST00000112217] [ENSMUST00000112219] [ENSMUST00000112222] [ENSMUST00000112225]
AlphaFold Q9EPK8
Predicted Effect probably damaging
Transcript: ENSMUST00000071968
AA Change: R64C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071859
Gene: ENSMUSG00000014158
AA Change: R64C

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 468 730 9.9e-13 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112217
AA Change: R64C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107836
Gene: ENSMUSG00000014158
AA Change: R64C

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 1e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 2e-12 BLAST
ANK 369 397 1.02e3 SMART
transmembrane domain 409 431 N/A INTRINSIC
Pfam:Ion_trans 455 658 3.3e-8 PFAM
Blast:PHB 693 744 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112219
AA Change: R64C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107838
Gene: ENSMUSG00000014158
AA Change: R64C

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 350 1.02e3 SMART
transmembrane domain 362 384 N/A INTRINSIC
Pfam:Ion_trans 408 611 3e-8 PFAM
Blast:PHB 646 697 4e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112222
AA Change: R64C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107840
Gene: ENSMUSG00000014158
AA Change: R64C

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 4.86e1 SMART
Blast:ANK 273 309 2e-12 BLAST
ANK 322 351 3.49e0 SMART
low complexity region 368 378 N/A INTRINSIC
Blast:ANK 395 420 1e-6 BLAST
Pfam:Ion_trans 468 671 3.4e-8 PFAM
Blast:PHB 706 757 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112225
AA Change: R64C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107844
Gene: ENSMUSG00000014158
AA Change: R64C

DomainStartEndE-ValueType
low complexity region 41 48 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
Blast:ANK 190 225 2e-11 BLAST
ANK 237 266 2.54e-2 SMART
ANK 284 313 5.58e1 SMART
Blast:ANK 320 356 3e-12 BLAST
ANK 369 398 3.49e0 SMART
low complexity region 415 425 N/A INTRINSIC
Blast:ANK 442 467 1e-6 BLAST
Pfam:Ion_trans 515 718 3.4e-8 PFAM
Blast:PHB 753 804 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a null allele show abnormal touch/ nociception and late-onset hearing loss. Homozygotes for a different null allele show impaired bladder voiding, abnormalities in touch/ nociception, osmotic regulation and vasodilation, ocular hypertension but no hearing or vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Lsm3 T C 6: 91,522,272 V87A possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Trpv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Trpv4 APN 5 114628625 missense probably damaging 1.00
IGL01804:Trpv4 APN 5 114644786 missense possibly damaging 0.77
IGL01955:Trpv4 APN 5 114622682 nonsense probably null
IGL02115:Trpv4 APN 5 114625029 missense probably damaging 1.00
IGL02375:Trpv4 APN 5 114636357 missense probably benign 0.10
IGL02870:Trpv4 APN 5 114625056 missense probably damaging 1.00
PIT4472001:Trpv4 UTSW 5 114626923 missense probably damaging 0.99
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0045:Trpv4 UTSW 5 114636457 missense probably benign
R0217:Trpv4 UTSW 5 114634661 missense possibly damaging 0.68
R0346:Trpv4 UTSW 5 114630529 splice site probably benign
R0358:Trpv4 UTSW 5 114630432 missense probably damaging 1.00
R1745:Trpv4 UTSW 5 114633154 missense probably damaging 1.00
R1880:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R1881:Trpv4 UTSW 5 114623626 missense probably benign 0.00
R2018:Trpv4 UTSW 5 114634605 missense probably damaging 1.00
R2093:Trpv4 UTSW 5 114635504 missense probably damaging 1.00
R2679:Trpv4 UTSW 5 114635552 missense probably damaging 1.00
R3699:Trpv4 UTSW 5 114634800 missense probably damaging 1.00
R4731:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4732:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4733:Trpv4 UTSW 5 114622753 missense possibly damaging 0.81
R4822:Trpv4 UTSW 5 114630022 missense possibly damaging 0.66
R4985:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R4987:Trpv4 UTSW 5 114622732 missense probably benign 0.00
R5026:Trpv4 UTSW 5 114622654 makesense probably null
R5105:Trpv4 UTSW 5 114626920 missense probably damaging 1.00
R5236:Trpv4 UTSW 5 114622795 missense possibly damaging 0.81
R5330:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5331:Trpv4 UTSW 5 114635543 missense probably damaging 1.00
R5396:Trpv4 UTSW 5 114623614 missense possibly damaging 0.77
R5423:Trpv4 UTSW 5 114636445 missense probably benign 0.25
R5667:Trpv4 UTSW 5 114634556 missense probably damaging 1.00
R5896:Trpv4 UTSW 5 114622647 utr 3 prime probably benign
R6239:Trpv4 UTSW 5 114644826 missense probably benign
R6762:Trpv4 UTSW 5 114625110 missense probably benign 0.07
R6952:Trpv4 UTSW 5 114633202 missense probably damaging 1.00
R7191:Trpv4 UTSW 5 114633140 missense probably benign
R7343:Trpv4 UTSW 5 114636459 missense probably benign 0.42
R7951:Trpv4 UTSW 5 114622810 missense probably benign 0.33
R8551:Trpv4 UTSW 5 114630839 missense possibly damaging 0.96
R8803:Trpv4 UTSW 5 114634755 missense probably benign 0.08
R8871:Trpv4 UTSW 5 114630450 missense probably benign 0.00
R9228:Trpv4 UTSW 5 114634561 missense probably benign 0.02
R9250:Trpv4 UTSW 5 114626880 missense probably damaging 1.00
R9291:Trpv4 UTSW 5 114630007 missense probably benign
R9304:Trpv4 UTSW 5 114644641 nonsense probably null
R9383:Trpv4 UTSW 5 114658413 start gained probably benign
Z1177:Trpv4 UTSW 5 114634612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTGTGATGGATTCAATACC -3'
(R):5'- ATGGCAGATCCTGGTGATGG -3'

Sequencing Primer
(F):5'- CGTGTGATGGATTCAATACCAACCAG -3'
(R):5'- AGATCCTGGTGATGGTCCCC -3'
Posted On 2014-10-02