Incidental Mutation 'R2172:Lsm3'
ID 237549
Institutional Source Beutler Lab
Gene Symbol Lsm3
Ensembl Gene ENSMUSG00000034192
Gene Name LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms SMX4, USS2, 6030401D18Rik, 2610005D18Rik, 1010001J12Rik
MMRRC Submission 040174-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R2172 (G1)
Quality Score 184
Status Not validated
Chromosome 6
Chromosomal Location 91493017-91499602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91499254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000145568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040607] [ENSMUST00000206947]
AlphaFold P62311
Predicted Effect possibly damaging
Transcript: ENSMUST00000040607
AA Change: V87A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044178
Gene: ENSMUSG00000034192
AA Change: V87A

DomainStartEndE-ValueType
Sm 19 97 3.79e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205609
Predicted Effect possibly damaging
Transcript: ENSMUST00000206947
AA Change: V87A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 38,123,613 (GRCm39) E441V probably damaging Het
Arfip2 T A 7: 105,287,195 (GRCm39) D64V probably damaging Het
Atg9a C A 1: 75,162,329 (GRCm39) R527L probably damaging Het
Atp1a1 T G 3: 101,497,864 (GRCm39) I308L probably benign Het
Bcan T A 3: 87,903,888 (GRCm39) Y199F probably damaging Het
Bsn T C 9: 107,987,191 (GRCm39) probably benign Het
Ccdc158 A T 5: 92,780,367 (GRCm39) L902H probably damaging Het
Dnah7b A G 1: 46,163,672 (GRCm39) Y492C probably benign Het
Dnah9 G T 11: 65,963,605 (GRCm39) H1783N probably damaging Het
Dpep2 A G 8: 106,715,630 (GRCm39) V320A possibly damaging Het
Dsc2 A G 18: 20,178,559 (GRCm39) Y282H probably damaging Het
Egfr C T 11: 16,861,562 (GRCm39) P1114S probably benign Het
Fastkd1 A G 2: 69,530,477 (GRCm39) S560P probably damaging Het
Gm14295 G A 2: 176,502,895 (GRCm39) R795Q possibly damaging Het
Gpr155 C T 2: 73,212,471 (GRCm39) V51I probably benign Het
Gsap G A 5: 21,427,438 (GRCm39) probably null Het
Hecw1 T A 13: 14,552,291 (GRCm39) I103F probably damaging Het
Herc3 T A 6: 58,864,422 (GRCm39) N685K probably damaging Het
Hnrnph1 T A 11: 50,273,643 (GRCm39) D244E probably benign Het
Hydin A G 8: 111,308,681 (GRCm39) E3989G probably benign Het
Ibsp T C 5: 104,458,296 (GRCm39) Y278H probably damaging Het
Ift57 T G 16: 49,579,703 (GRCm39) N291K probably benign Het
Il15ra A G 2: 11,728,382 (GRCm39) T149A possibly damaging Het
Ints5 C T 19: 8,873,646 (GRCm39) T535I possibly damaging Het
Jarid2 T C 13: 45,056,015 (GRCm39) L268P probably damaging Het
Klhdc7a T A 4: 139,693,121 (GRCm39) T609S probably benign Het
Lrrc49 A G 9: 60,509,965 (GRCm39) V429A probably benign Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Map1a G T 2: 121,138,413 (GRCm39) V2726L probably damaging Het
Marveld3 A C 8: 110,688,478 (GRCm39) S88A probably benign Het
Mcm9 T C 10: 53,424,670 (GRCm39) D640G probably damaging Het
Mettl4 A G 17: 95,040,591 (GRCm39) I399T probably benign Het
Mmp27 T A 9: 7,577,379 (GRCm39) L274* probably null Het
Nacc2 A C 2: 25,950,235 (GRCm39) D500E probably benign Het
Nprl3 T A 11: 32,184,894 (GRCm39) M372L probably benign Het
Or5p6 A T 7: 107,630,674 (GRCm39) I292N probably damaging Het
Otud7b T G 3: 96,060,837 (GRCm39) probably null Het
Pcx G A 19: 4,670,909 (GRCm39) R1070H probably benign Het
Ptprq C T 10: 107,426,855 (GRCm39) W1560* probably null Het
Puf60 A T 15: 75,942,313 (GRCm39) I520N probably damaging Het
Qars1 C T 9: 108,386,399 (GRCm39) R143C probably damaging Het
Rfx3 G A 19: 27,792,894 (GRCm39) Q322* probably null Het
Samd14 G T 11: 94,905,217 (GRCm39) V10L probably benign Het
Setd2 G A 9: 110,378,912 (GRCm39) R909Q probably benign Het
Sh2d4a T C 8: 68,749,316 (GRCm39) S117P probably benign Het
Sharpin C A 15: 76,234,866 (GRCm39) probably benign Het
Skor1 C A 9: 63,052,404 (GRCm39) A494S possibly damaging Het
Slc41a2 T C 10: 83,119,638 (GRCm39) T375A probably benign Het
Sparc G A 11: 55,286,627 (GRCm39) Q324* probably null Het
Spopfm2 T G 3: 94,083,605 (GRCm39) K69Q possibly damaging Het
Srebf1 T C 11: 60,097,328 (GRCm39) T171A probably benign Het
Srrd A G 5: 112,488,988 (GRCm39) I54T possibly damaging Het
Tecpr1 G T 5: 144,133,235 (GRCm39) Q1072K probably damaging Het
Tecpr1 A T 5: 144,148,274 (GRCm39) V377E probably benign Het
Tln1 T A 4: 43,545,721 (GRCm39) H919L probably benign Het
Tm9sf3 C T 19: 41,205,859 (GRCm39) S516N probably damaging Het
Trpa1 T A 1: 14,951,880 (GRCm39) T940S probably benign Het
Trpv4 G A 5: 114,782,771 (GRCm39) R64C probably damaging Het
Tufm A G 7: 126,088,019 (GRCm39) E174G probably benign Het
Urb2 A G 8: 124,757,841 (GRCm39) T1183A probably damaging Het
Virma A T 4: 11,527,843 (GRCm39) M1245L possibly damaging Het
Vmn2r32 T C 7: 7,477,614 (GRCm39) Y259C probably damaging Het
Zfp329 A G 7: 12,544,694 (GRCm39) F277L probably damaging Het
Zfp683 C T 4: 133,783,106 (GRCm39) T190I possibly damaging Het
Other mutations in Lsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Lsm3 APN 6 91,493,070 (GRCm39) splice site probably benign
R6552:Lsm3 UTSW 6 91,496,617 (GRCm39) frame shift probably null
R6553:Lsm3 UTSW 6 91,496,617 (GRCm39) frame shift probably null
R6555:Lsm3 UTSW 6 91,496,617 (GRCm39) frame shift probably null
R6588:Lsm3 UTSW 6 91,496,617 (GRCm39) frame shift probably null
R6689:Lsm3 UTSW 6 91,496,617 (GRCm39) frame shift probably null
R8022:Lsm3 UTSW 6 91,496,543 (GRCm39) missense probably benign 0.10
R8859:Lsm3 UTSW 6 91,499,252 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTACCTTGTGTCCGGGTC -3'
(R):5'- TGCTTGCAAATGAACTTCTTCGAG -3'

Sequencing Primer
(F):5'- TCTGGTCACAAAGAAGCCTG -3'
(R):5'- TGCAAATGAACTTCTTCGAGGGTAG -3'
Posted On 2014-10-02