Incidental Mutation 'R2172:Lsm3'
ID 237549
Institutional Source Beutler Lab
Gene Symbol Lsm3
Ensembl Gene ENSMUSG00000034192
Gene Name LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms 2610005D18Rik, SMX4, USS2, 1010001J12Rik, 6030401D18Rik
MMRRC Submission 040174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock # R2172 (G1)
Quality Score 184
Status Not validated
Chromosome 6
Chromosomal Location 91515928-91522625 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91522272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000145568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040607] [ENSMUST00000206947]
AlphaFold P62311
Predicted Effect possibly damaging
Transcript: ENSMUST00000040607
AA Change: V87A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044178
Gene: ENSMUSG00000034192
AA Change: V87A

DomainStartEndE-ValueType
Sm 19 97 3.79e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205609
Predicted Effect possibly damaging
Transcript: ENSMUST00000206947
AA Change: V87A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 T A 18: 37,990,560 E441V probably damaging Het
Arfip2 T A 7: 105,637,988 D64V probably damaging Het
Atg9a C A 1: 75,185,685 R527L probably damaging Het
Atp1a1 T G 3: 101,590,548 I308L probably benign Het
Bcan T A 3: 87,996,581 Y199F probably damaging Het
Bsn T C 9: 108,109,992 probably benign Het
Ccdc158 A T 5: 92,632,508 L902H probably damaging Het
Dnah7b A G 1: 46,124,512 Y492C probably benign Het
Dnah9 G T 11: 66,072,779 H1783N probably damaging Het
Dpep2 A G 8: 105,988,998 V320A possibly damaging Het
Dsc2 A G 18: 20,045,502 Y282H probably damaging Het
Egfr C T 11: 16,911,562 P1114S probably benign Het
Fastkd1 A G 2: 69,700,133 S560P probably damaging Het
Gm10696 T G 3: 94,176,298 K69Q possibly damaging Het
Gm14295 G A 2: 176,811,102 R795Q possibly damaging Het
Gpr155 C T 2: 73,382,127 V51I probably benign Het
Gsap G A 5: 21,222,440 probably null Het
Hecw1 T A 13: 14,377,706 I103F probably damaging Het
Herc3 T A 6: 58,887,437 N685K probably damaging Het
Hnrnph1 T A 11: 50,382,816 D244E probably benign Het
Hydin A G 8: 110,582,049 E3989G probably benign Het
Ibsp T C 5: 104,310,430 Y278H probably damaging Het
Ift57 T G 16: 49,759,340 N291K probably benign Het
Il15ra A G 2: 11,723,571 T149A possibly damaging Het
Ints5 C T 19: 8,896,282 T535I possibly damaging Het
Jarid2 T C 13: 44,902,539 L268P probably damaging Het
Klhdc7a T A 4: 139,965,810 T609S probably benign Het
Lrrc49 A G 9: 60,602,682 V429A probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Map1a G T 2: 121,307,932 V2726L probably damaging Het
Marveld3 A C 8: 109,961,846 S88A probably benign Het
Mcm9 T C 10: 53,548,574 D640G probably damaging Het
Mettl4 A G 17: 94,733,163 I399T probably benign Het
Mmp27 T A 9: 7,577,378 L274* probably null Het
Nacc2 A C 2: 26,060,223 D500E probably benign Het
Nprl3 T A 11: 32,234,894 M372L probably benign Het
Olfr478 A T 7: 108,031,467 I292N probably damaging Het
Otud7b T G 3: 96,153,520 probably null Het
Pcx G A 19: 4,620,881 R1070H probably benign Het
Ptprq C T 10: 107,590,994 W1560* probably null Het
Puf60 A T 15: 76,070,464 I520N probably damaging Het
Qars C T 9: 108,509,200 R143C probably damaging Het
Rfx3 G A 19: 27,815,494 Q322* probably null Het
Samd14 G T 11: 95,014,391 V10L probably benign Het
Setd2 G A 9: 110,549,844 R909Q probably benign Het
Sh2d4a T C 8: 68,296,664 S117P probably benign Het
Sharpin C A 15: 76,350,666 probably benign Het
Skor1 C A 9: 63,145,122 A494S possibly damaging Het
Slc41a2 T C 10: 83,283,774 T375A probably benign Het
Sparc G A 11: 55,395,801 Q324* probably null Het
Srebf1 T C 11: 60,206,502 T171A probably benign Het
Srrd A G 5: 112,341,122 I54T possibly damaging Het
Tecpr1 G T 5: 144,196,417 Q1072K probably damaging Het
Tecpr1 A T 5: 144,211,456 V377E probably benign Het
Tln1 T A 4: 43,545,721 H919L probably benign Het
Tm9sf3 C T 19: 41,217,420 S516N probably damaging Het
Trpa1 T A 1: 14,881,656 T940S probably benign Het
Trpv4 G A 5: 114,644,710 R64C probably damaging Het
Tufm A G 7: 126,488,847 E174G probably benign Het
Urb2 A G 8: 124,031,102 T1183A probably damaging Het
Virma A T 4: 11,527,843 M1245L possibly damaging Het
Vmn2r32 T C 7: 7,474,615 Y259C probably damaging Het
Zfp329 A G 7: 12,810,767 F277L probably damaging Het
Zfp683 C T 4: 134,055,795 T190I possibly damaging Het
Other mutations in Lsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Lsm3 APN 6 91516088 splice site probably benign
R6552:Lsm3 UTSW 6 91519635 frame shift probably null
R6553:Lsm3 UTSW 6 91519635 frame shift probably null
R6555:Lsm3 UTSW 6 91519635 frame shift probably null
R6588:Lsm3 UTSW 6 91519635 frame shift probably null
R6689:Lsm3 UTSW 6 91519635 frame shift probably null
R8022:Lsm3 UTSW 6 91519561 missense probably benign 0.10
R8859:Lsm3 UTSW 6 91522270 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTACCTTGTGTCCGGGTC -3'
(R):5'- TGCTTGCAAATGAACTTCTTCGAG -3'

Sequencing Primer
(F):5'- TCTGGTCACAAAGAAGCCTG -3'
(R):5'- TGCAAATGAACTTCTTCGAGGGTAG -3'
Posted On 2014-10-02